SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06838
Annotation
PREDICTED:_uncharacterized_protein_K02A2.6-like_[Amyelois_transitella]
Location in the cell
Nuclear   Reliability : 2.302
 

Sequence

CDS
ATGGAACACGCCCGACCACCGTCAGAATTGAGTCTGGAAGGCAACTCCGTCAGCCGGGCTGACGCATGGAAGCGTTGGAGGAAACAATTTCATCTATTTTTGAAAGCATCAGGGGTGCATAAAGAAGAAGGCAGTGTGCAAGCCAGCTTGCTCATCAATTTAATTGGAACGGAAGGTTTCGATGTGTACGAGACGTTCAAGTTTTCAAATGACACTGAAAAAGATGACGTAACGGTTTTGTTAAAAAAATTCGACGAATACTTCGGCGTCAAACCGAATGTTACGTTGGCGAGATATAATTTCTACATGAGAAACCAGGAAGGCGGCGAGTCCATAGATCAGTATGTGACGGCTTTGAAGCTGCTGAGCAAAACCTGTGAATTTAAAACCTTAGAAGAGGAATTCATTCGCGATCGGATCGTATGCGGCATAAAAAATACGATAGTTCGCGATCGTTTACTGAGAACGGACGACCTAACGATGGACAAAGCTATTAAAATATGCCAAGTCGACGAGGTATCGGCGGACAGCAGTCGCGTATTGCAGGAGTCGCGCGGAGCGAGTGCGGGGCCGGTGCGCGTGGACGCTGTGGGCGCGCGGGGTGGTGCTGGGCCACGTGCGGCGCGGGGTCGAGCCGGCTATGCGCGAGCAGCTCGCGGCGGCCGCGGCGGTCACCGGCTGCGTGCGGTCCCGGATGGCGCGGGGCGCCCGCCGCCTCTTTCCAGTTCATCTGCGTCCAGTACTTGTCTCAGGTGCGGAGGTCCGTGTGTTAGTTGGGCTGACTGTCCTGCGGTCTCAGTGCAGTGTTATGTGTGTCAAAATTATGGTCATTTTGCAAGAATGTGTCAAGTACATAAAGGTGTAAAAAAGTTATATGATATCGGTGTTCTAGAGGACGAAAATAAATACGAGCCGGAACTGGACGATGACTGGGAGTCGTTTTATATATCTACTTTAATTGATGGTTCCAAAATCGACTCGGTGTCGCAGGATTGGTTTGAGGTCCTCCGAGGAGAATGGGGCTCGGAAAATTTTAAACTAGACTCGGGTGCAGATATCAATGTCTTATCTTTTAAGCGATTTGTGCAGTTAGGCAATAACCCTAATAACATTGTTGTAAATCATAAGGTTAAACTGCAATCTTACAGTGGCGATTTCATTCCTATTAAGGGAATTTGTAACATTAAATGGTGGTATAAAAATGTTCAATATGATCTTAAGTTTGCGATAGCTGATATTGATTGTCAAAGTGTACTGGGACTGCAGGCGTGCTTATTATTAGGGTTAATAAAAAGAATTCACGATATAAATTTCTCTAAAAATAGTGATTTGTTCACTGGGTTAGGTTGTTTACCGGGGGAATATCATATAACGGTAGATAGGGATGTGACGCCGGTGGTGTGCGCTCCGCGGAAAGTACCGTTAAGCCTTCGTGATAACTTGAAGGACGAACTCGATAGGATGACAGAGTTAGGTGTGATTAGGAAGGTGACTCATCCGACACCTTGGGTCAACTCGTTAGTAGTAGTGGCCAAGACAAATGGTAAAATGCGCATATGCCTAGACCCGAGGCCTCTCAATAAGGCGATTCAACGTGCTCATTTTCAACTACCCACCATAAATGAGTTGGCTACCAAATTGAATGGGGCTAAATATTTTTCGGTATTGGACGCCAATTCAGGATTTTGGTCCGTAAAGCTAGATAAGGAGAGCGCCGATTTATGCACATTTATTACGCCGTTTGGGCGATATCAATATCTAAGATTACCGTTCGGACTGAACTGCGCACCGGAGGTATTCCACGCTAAATTAAAACAATTGTTAGAAGGTTTAGACGGTGTTGAGTCGTTTATTGATGATATTATTGTCTGGGGGTCCACTAGGCGAGAACATGATGTAAGACTAAATGCGTTATTTCAAAAAGCGCGAGATATTAATTTAAAGTTTAACAAAGATAAGTGTCGCATTTGTGTCGATGAGGTGACATATTTGGGACATATTTTTAATAAAGACGGAATGAAAGTAGATACGGAAAAAGTGCGGGCTGTAATCAATATGCCGGAACCTACGGATTGTAAAAGTTTAGAAAGGTTCTTGGGTGCAATTAATTATTTATCAAAGTTTATACCTAACTACTCGCAACACATATTTCCATTGACTAGATTATTGAAAAAAGATGTCGAGTGGTGTTGGGAAATAGGTCACAAAAACGCCTTTGATAAATTAAAGAAACTGATATGCGAGGCTCCGGTATTATCGTTGTTTGACGTAGGCAGTGAGGTATTGTTGTCGGTGGACGCGAGCAGCGTCGCACTTGGCGCGGTGCTGATGCAGCGCGGCCGCCCGGTCGAGTACGCGTCGCGCACACTCACCGACACACAACAGAGATACGCTCAGATTGAAAAAGAAATGTTAGCTATTGTCTTTGCTTGTGAAAAATTTCACCAGTACATTTATGGAAAAAGGTATATAGTCATAGAAACTGACCATAAACCTCTTGAAAGTATTTTTAAAAAGCCGCTCAATTCAGTCCCAGCACGCTTGCAGCGTATGATGTTAAAATTACAAGGGTACGATCTGAAAATTACTTATAAACCGGGGAAGTATATGTATATACCCGACACGTTATCACGTGCGCCTCTTCCGGATTTATATGACGATAAAATTAGTAAGGCAGTATTGAACCAATTGAAAATGGTAATTAACAATGTACCGATGTCTCAAAGCAAACTGACATTAGTTAAGAAAGAAACTAGTAAAGATGAGTATTTGAAACGTTTGTTAGTTTACATTAATGAAGGTTGGCCCGTTCATAAATATAATGTTGATAGTGATTTAAAGTATTTTTGGTCCATGAGAGACGAGCTGTACTCTGTTGACGGAGTAATTTTTAAAGATAAACAGCAACAGCATAAAACAATAATAGAAAAACAATTAAAAAGTAAAATGTATTATGACCAACATTGTAAAGCGCAGCCGGAGCTAAGTGTCGGCGATGATGTAATTATGTTAGAACATAATAATGAACGAATGCGCGGCACTGTCGTAGGCAAGGCATCTGCACCGCGTTCATACATTGTAAAAAACAAATTAGGTATATATCGACGTAATCGCCGACATTTAATTAAAAATATGCCTGATGAGAAACCTAATGTTGTGGAAAAGCTGAAGAATGATCGGCGCGGCACAATAGTGATCGTATCAGACGAGTCAAGTGGGGGAGAATATGAGATGAGTGTGGATGAGGATGGTTCAGTGTACGAACCGAGTACTTTGTCATCACCTTCATCACCTCATATTTATCCGCCTACTACTCGTAGTAGAACTAAGCAGAATGCAATTAATAATAATTAA
Protein
MEHARPPSELSLEGNSVSRADAWKRWRKQFHLFLKASGVHKEEGSVQASLLINLIGTEGFDVYETFKFSNDTEKDDVTVLLKKFDEYFGVKPNVTLARYNFYMRNQEGGESIDQYVTALKLLSKTCEFKTLEEEFIRDRIVCGIKNTIVRDRLLRTDDLTMDKAIKICQVDEVSADSSRVLQESRGASAGPVRVDAVGARGGAGPRAARGRAGYARAARGGRGGHRLRAVPDGAGRPPPLSSSSASSTCLRCGGPCVSWADCPAVSVQCYVCQNYGHFARMCQVHKGVKKLYDIGVLEDENKYEPELDDDWESFYISTLIDGSKIDSVSQDWFEVLRGEWGSENFKLDSGADINVLSFKRFVQLGNNPNNIVVNHKVKLQSYSGDFIPIKGICNIKWWYKNVQYDLKFAIADIDCQSVLGLQACLLLGLIKRIHDINFSKNSDLFTGLGCLPGEYHITVDRDVTPVVCAPRKVPLSLRDNLKDELDRMTELGVIRKVTHPTPWVNSLVVVAKTNGKMRICLDPRPLNKAIQRAHFQLPTINELATKLNGAKYFSVLDANSGFWSVKLDKESADLCTFITPFGRYQYLRLPFGLNCAPEVFHAKLKQLLEGLDGVESFIDDIIVWGSTRREHDVRLNALFQKARDINLKFNKDKCRICVDEVTYLGHIFNKDGMKVDTEKVRAVINMPEPTDCKSLERFLGAINYLSKFIPNYSQHIFPLTRLLKKDVEWCWEIGHKNAFDKLKKLICEAPVLSLFDVGSEVLLSVDASSVALGAVLMQRGRPVEYASRTLTDTQQRYAQIEKEMLAIVFACEKFHQYIYGKRYIVIETDHKPLESIFKKPLNSVPARLQRMMLKLQGYDLKITYKPGKYMYIPDTLSRAPLPDLYDDKISKAVLNQLKMVINNVPMSQSKLTLVKKETSKDEYLKRLLVYINEGWPVHKYNVDSDLKYFWSMRDELYSVDGVIFKDKQQQHKTIIEKQLKSKMYYDQHCKAQPELSVGDDVIMLEHNNERMRGTVVGKASAPRSYIVKNKLGIYRRNRRHLIKNMPDEKPNVVEKLKNDRRGTIVIVSDESSGGEYEMSVDEDGSVYEPSTLSSPSSPHIYPPTTRSRTKQNAINNN

Summary

Pfam
PF17921   Integrase_H2C2        + More
PF17919   RT_RNaseH_2
PF00078   RVT_1
PF00665   rve
PF03732   Retrotrans_gag
PF11838   ERAP1_C
Interpro
IPR036397   RNaseH_sf        + More
IPR041588   Integrase_H2C2       
IPR000477   RT_dom       
IPR021109   Peptidase_aspartic_dom_sf       
IPR012337   RNaseH-like_sf       
IPR041577   RT_RNaseH_2       
IPR001584   Integrase_cat-core       
IPR001995   Peptidase_A2_cat       
IPR001969   Aspartic_peptidase_AS       
IPR005162   Retrotrans_gag_dom       
IPR036875   Znf_CCHC_sf       
IPR001878   Znf_CCHC       
IPR024571   ERAP1-like_C_dom       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF57756   SSF57756       
Gene 3D
PDB
4OL8     E-value=5.70417e-53,     Score=529

Ontologies

Topology

Length:
1117
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00111
Exp number, first 60 AAs:
0.00015
Total prob of N-in:
0.00002
outside
1  -  1117
 
 

Population Genetic Test Statistics

Pi
2.127899
Theta
2.170402
Tajima's D
-1.701354
CLR
57.027364
CSRT
0.0269986500674966
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号