SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06813
Annotation
PREDICTED:_serine/arginine_repetitive_matrix_protein_1-like_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.517
 

Sequence

CDS
ATGATGGCAAACTTAAAAATAAAATTACCCCAGGAGGGTACCACCCTAGGTGGAGAATCCCTCCGTGCTTCCACCTCGGTGGGAGCATGCTGCCCCGCGTATTCTGGGGGGGGCAAAGCATGCCACGATGAAGGGGGCTGTGCGACGGGCAGCGGAAAACCCGTCGAACCGAGGTGTGACAGCGCTGGCTCGACGCGCTCTGCGCTCGTCAGCGAAGGCGAGGCGGCTGGTCCGAAAGGGACAACCGCCAAGAAGATTAGGCGGAAGAGGAAGTCTTGGCGAGCTTCCTCTCGTGAGGGGGTAGGGGAGCCAGCGTCATCCTCTGGCGCAGATGCCCCGCCGGAAAAGGTGTTGGTAATCTCCGATGCAGCCTCTGCTGCGGAGGAGATGCCGCCCCCTAGAGGGAGACCCGCCCGGAAAAGGGGCGCGCCGTCACCGGCGCCATCATCAGTGTCAATGTCTGTCGCCTCGTTGGATGGGCAGACGACAGAGGAGGAAGAGAGCGGCCTTCAGGATCCTGCCATGGTCATAGACAGGGCCATGAAGACCGTGAAATCATACGCGGCCAATGGCACCAAGACCAAAGCCGCTGGTCGTAAACTGCGAGAAGTGGTCTCGCAGGTCTCGAAAGTTCTGCCATCAGTTGCTTCTGCCAATGACCAGGTGGTACAGCTGATGGCGGAGAATTTGAGACTTCGAGCACAGCTCCAAGCTCGGCAACGGCCCGATGATGGAGCAGCGACGTCCTGGGTCGCTGGAGCCCCTCGGAGCTCCCGTCTCCCGGCGCTGACTGGTGATCAGTGGCCTGTGCTGCCACCACCGCGTGCGGCACAGGAGCGTCCGCGTCTCCCGTCACCGCGCTCCAGAGAGACGACCGCCGCCGCGCGGCAGCAAGCACTCGCGGGGCCACGGATGCTGGCTCCGCCAGAACCGAAGACCTTCAGCCTGGACGAGGTCATCAACCGCACCGTCCAGGCTGTAGTAGAAAAGCTGGGCGGGAGGCTAGCGGCTCTCGAGGCGAGAGTGACTGTTTCGGCCGACGTTAGGCAGCCGGCGGTGACGGGTGCTTTGGCCACCCGTTCCGCTCCCGTACGGGCTCCGGCCACCAGGTCGGGCCCGGGACGGGATCGAACTAAGCGAGGGGGCGGCGCTAACGCGAAGCCTCCATCACAAGCACCCCAGTCCCGTCCGCTGCCTCCGCCCCCGTCAGACATGGACGAGGGGTGGAACGTGGTGGCCCGGCGGGGTGCCAAAAAGGCCTCACTGGCAGCTCCCCAAATGGGTAGAGCGCCAGTGGCCATGGCGGTTCAGGCTGCACCCCAACAGGGTCGAGCACCTGTAGCCGCCAAGAAAAACAAAAAAACAAAAAAAAAAGGGAAGAAGTCGTCGCGGGTGCCGCGATCAGCGGCAGTGGTTCTAACTTTACTGCCTGCCGCTGAGGCCAAGGGCATCACATATAATGATGTGATGGCCCGGGCGCGTGAAGCAGTCAACCTGGACGAGATTGGGGCGGAGGAGGGCCTCCGCAGCAGGCAGACGGCCAATGGGGCCAAGCTGTTAGAGTGTCCCGGTGCCGATAGTCCCGGCATCGCGGAGCGTCTGGCGGCGAAGCTCCGTATGGTCTTGCCTGAGGAGGAGGTGCGGGTGCACAGGCCGGTAAAAATGGCGGAATTAAGAGTGACCGGCCTGGACGACTGCACCACCAGGGATGAGGTGAGAGCGGCCGTCGCTACCCAGGGCAACTGTGCACCGGAGAATGTAACCGTGGGTGAGCTGCGCCGTGGTTATAACGGGGCCAGCTCAGTGTGGGTGCGTTGCCCGTTGGAGACGGCTGCCTCCCTGGCTGCTCCTCCGCCCGGGGGACCGTCGGGGAATCCAGGCAGGCTGCGCGTGGGCTGGATAGCGGCCCACGTGCGCCTGCTTGAACCACGCGCCTGGCGATGCCTCCGATGCTTTAGCACCGGACACGGTCTCGCCAGGTGCACTAGCTCGGTTGACCGCAGCGGTCTGTGTTTCCGCTGCGGCCAGCCGGGCCATAAAGCGGCGTCCTGCGCGGCCGCCCCGCACTGCACTCTGTGCGCTGCGGCCGGGCGCGGGGCTAACCACCGGGCGGGAGGAAAGGCGTGCCTCCCGTCCGGTGATAACACCGAACGCAACCGGCACCGGAAGTCAAAGCGCCGGCAGAGGAGAAAGTTGGCCAGAGGAGCACTGGCCAACGCTGTAATCCCCGCTGCGGCACCGGTGCCGGAGGGTGGGGGCAGCGGTGAAGGGGAGGGAGCGATGGATGTGGTCCAACAGTAA
Protein
MMANLKIKLPQEGTTLGGESLRASTSVGACCPAYSGGGKACHDEGGCATGSGKPVEPRCDSAGSTRSALVSEGEAAGPKGTTAKKIRRKRKSWRASSREGVGEPASSSGADAPPEKVLVISDAASAAEEMPPPRGRPARKRGAPSPAPSSVSMSVASLDGQTTEEEESGLQDPAMVIDRAMKTVKSYAANGTKTKAAGRKLREVVSQVSKVLPSVASANDQVVQLMAENLRLRAQLQARQRPDDGAATSWVAGAPRSSRLPALTGDQWPVLPPPRAAQERPRLPSPRSRETTAAARQQALAGPRMLAPPEPKTFSLDEVINRTVQAVVEKLGGRLAALEARVTVSADVRQPAVTGALATRSAPVRAPATRSGPGRDRTKRGGGANAKPPSQAPQSRPLPPPPSDMDEGWNVVARRGAKKASLAAPQMGRAPVAMAVQAAPQQGRAPVAAKKNKKTKKKGKKSSRVPRSAAVVLTLLPAAEAKGITYNDVMARAREAVNLDEIGAEEGLRSRQTANGAKLLECPGADSPGIAERLAAKLRMVLPEEEVRVHRPVKMAELRVTGLDDCTTRDEVRAAVATQGNCAPENVTVGELRRGYNGASSVWVRCPLETAASLAAPPPGGPSGNPGRLRVGWIAAHVRLLEPRAWRCLRCFSTGHGLARCTSSVDRSGLCFRCGQPGHKAASCAAAPHCTLCAAAGRGANHRAGGKACLPSGDNTERNRHRKSKRRQRRKLARGALANAVIPAAAPVPEGGGSGEGEGAMDVVQQ

Summary

Uniprot
ProteinModelPortal

Ontologies

Topology

Length:
766
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00425
Exp number, first 60 AAs:
0.00016
Total prob of N-in:
0.00011
outside
1  -  766
 
 

Population Genetic Test Statistics

Pi
3.486094
Theta
12.756552
Tajima's D
-1.084735
CLR
24.46291
CSRT
0.12074396280186
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号