SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06812
Annotation
reverse_transcriptase_[Danaus_plexippus]
Location in the cell
Mitochondrial   Reliability : 1.156 Nuclear   Reliability : 1.642
 

Sequence

CDS
ATGCTACAAATCCCGTGGACAGCACACCAGGCTGACGCATCCATATTAAGACAGCTCAATATCCAAACTAGGCTCTCTGCCATACGCCTCAAGAGGATATCTGAGTTCTTCGGTCACATTGCCAGAAAGAGCGATGGAAATCTTGAAAAATTAATAGTAACTGGCAAGATCGCAGGCAAAAGACCTAGTGGCCACAATCCAGTGCAAAGTGAAGTAAGTGCTGTGGGTCCCGGTCGCAGACGGGACCCACAGCACCCAATCTGCGTGCTGTGGGTCCCGTCTGCGGAGGAGATGCTGGACTCCTACCGGGCGCGTCCTACCGGACGATTTGTGAGCCGGAACAAGGCTGATCCGAGGACTCGGAGGAAGCGGAAGACGGTCAAACGACCAGTGACTCCCGCTCTCTCCGACTCCTCGGAGATTGAGCTCGCGCCTGCCAAATTTTTGGCAGTCGAGGATGGGCCGGCGGATGCTACAGGATCATCTGCCAAAGAACGCGGTCGACAAGATCTTACGGTGACCTACGGAGAATCGGCTGTCACCACCTCGGTGCGGACCGGAGCCTTCCGCCGTAAAGAAGCTGGTCTGGTGAGAGAAGGCGAGGTCGAGCGACTAACCCGCTCCCTCACAGAAGTGGACACAATGGACCCGCGGAAGGCGGTTGAAATTTCGCTGGAAATTGTTTCCATGGTGGCGGCCAAATCAGGCTCCCTGAAGGGCACGTACGTGCGGGCCCTGAAGTGCGTGGCTGCCGCCGTGGAGAAGCTATTGGACGAGTTTCTACGACGCACTAGTACGGAGGAAGTAACCTGTCTGCGGTCGCAGCTGGAGCAACTGTTGGCAGAAAACTCAGAGCTTCGAGCGGAGGGCGTGCGGGTGCGGGAAGAGATGGCCGAAATGCGTGCATCCCTTGACGGTTTATTGGGACAGCAGGGTAGATTAGCCTCTCCGTCGCCCCCGTCTCCATCAAATGAAAGAGCGGAAAATGAGAAGGACAAGGAAATAGAGGAACTAAAGAGACGAATAGCAATCCTCGAGGCCCGCGCCTCCAAGGTTGAACGCGCAAGGCCTCCGCTGGCGCACGAGCGCCAGGCGCCTGCGCCGTCACCGTGCGACGCCTTAGCTGCACTGTCACGCACAAGAGCTGCAGGTACCAGGGTGGGTGCGGCACCTTCGGCACGCGCGTCCACCAAAGTGGCCGCGTCAAACAAGCCCGTTGGACGGCGAATGGCGGTCCAGCCCGTGAGGCCTCAGGCTGATGCTTCTGCCCCGCTCCAGCCTGCGAAGGCGGGGCCTGGCAGAAGCCGCAAGAACACAAAGGGGTGTGTGAATGCCGCCCAGCCGGCGCAACGCCCACAGCCCCGTCCACTACCTCCAGCCCCGTCCAACATGGAAGCAGCCTGGACGACGGTAGTGAAACGCGGTCGAAGGAGGGCGCTAGACGTTCCTAGCCCCCGTCCCGTCCCGACGGTCAACGCTCCCCAGGTAATGGGTCGAGCAGTGACTGAGGGAAAGAGAAAGGGAGGGCGCAAGGCAAGAAAACCGCGCGCCCCGCGGTCGGCGGCTGTCGTATTGGAGCTGCTGCCGGCTGCCAAGGAAAAGGGCCTCACCTATGGGGAGGTGATGGCCCGGGCGCGCGTTAGCGTCGACGTGGATGCCATGGGCGTGGAGGGTGGCCTCCGAGTCCGGCACACCGCCAATGGGGCCCGGTTGCTGGAGTGTCCTGGTGCCAACACCAGCGCGGTCGCGGACAGGGTAGCAGCCCGGCTCCGCGAAATCCTGCCGGACCCAGAACTGGTGCGTATAGACAGGCCCGTCAAGATGGCGGAAATCAAAGTGACGGGCCTGGATGAATGCGCCACTAAGGAGGAAGTGGCCGCCGCCATTGCATCGCAGGGCAATTGCGCCCTTACGCAGGTGAAGGTAGGAGAGTTGCGAAGCTCTTACTCTGGAGCCTTCACTGTGTGGGCGCGTTGCCCTATGCAGGCAGCCACACTCCTGGCTACGCCTCCACGAGGTCGGCCCGCCGACTCACCAGGGAGGCTACGCGTAGGCTGGGTGATAGCCCACGTGCAGCTACAGAAGGCCCGCCCCTGGCGATGCCTCCGGTGTTTCGGCACCGGGCACGGCCTCGCCAGGTGCCCGTCGGCTGTGGACCGCAGCGGTCTTTGTTTCCGCTGCGGCCAGCCCGGTCACAAGGCGGGCTCCTGCACAGCCGCCGCACCGCACTGCGTGCTATGCGACGCGGCGAAGCGGCGGGCCGATCATCGGGCCGGGGGCCCGTCCTGTCTTTCCGCACCCTCCTCCACAAAGAGGAGGCGTGGCGGAAAAAAGAAGAAAAATATAGAGGAAGGGCCGGCTGCCTGTGATACAGCCGGCCGGGCGCAGGATCTCCTCGTCCACACCATGGCGGAGTGGTTCATCGACATCGCGATCGTTGCGGAGCCATACTTCGTACCTCCCGACCGGGAGGATTCCTGGGCTGGAGATGTTGATGGCTCCGTGGCGATCGTGATGAGACAGTCTGCGGCGTTACCCCCCCTTGGAATGGTGGCCAGGGGATCCGGGTACGTCGTCGTTAGGGTCAACGAAACCGTCGTGATCGGGGTGTACTTCTCTCCGAACAGGAGTCTCGCTGAGTTCGAGCGGTTCCTGGGCGGGCTCGAGGCGTTGGTTCATCGCTTCGAGTCTCGCCCGGTGATACTGGCGGGGGACCTCAACGCTAAATGTACGGCGTGGGGTTCTCCCCGCACGGACTCGCGCGGCGAGTTCCTGTCGGAGTGGGCTTTCGCGACCGGCCTCTGTCTTCTGAACAGAGGTTCGGTCGCGACCTGCGTGCGGTGGAACGGGGAATCACACGTGGACGTGTCGTTCGCGTCTCCGTCTGCCGCACGCCGTGTCCGTGGCTGGCGTGTTCTCGAGGGGGCGGAGACGCTCTCGGACCATCGGTTCGTCCGATTTGAGCTCTCCGTTTCCACCTTGTTGAACGCGCCGGACGAAGACGCCCGCGGTGAGGAGGAGCTCCCGCGTAGTGCTCCCCGATCATTCCCGCGATGGGCACTGAAGCGCCTGAACAAGGTGCTTGCGGTGGAGGCGGCCACAGTGGCCGCGTGGGCGCCGCTGCCCGCGCGTCTAGTGGACGTGGAGTTGGAGGCCGAATGGTTCCGGGGTACGATGCGTCGCGTCTGCGATGCTGCGATGCCCCGGGTCAGCGGTCGCGCTCCGCGTGGCGGTGCGTATTGGTGGACGCCCGAGATCGCGCTCCTCCGAGAGGAGTGCGTGCGGGCGCGCCGCCGAAGCGCCCGCCACCGCCGTCGCCGCCTTCGCGATGCGGACTTCGCGGAGGTGGCGACCCGCCTGCATGCCGACTGCCGTCAGAAGCAGGAGGCACTGCGGCGGGCCATCGGCGAGGCCAAGTCTCAGAGCATGAAGACGCTCCTGGAGACGCTTGACCAAGATCCTTGGGGGCGCCCGTACCAAACGGTCCGCAAGAAATTGCGGCCGTGGGCGCTCCCGGTGACGGAACGTCTCCAGCCTCAGCAGCTGCGGGAGATTGTCTACGGGCTGTTCCCGCGGATGGAGAGGAGCTTCGAGCCCCCTTCCATGGGCGCGCCACCACGCAGTAGCGTGAGCGGACGCGGCCCCGGCCCTGACGGTGTTCACGGCCGGGTCTGGGATTTGGCCTTCGGTGCCCTTGGGGACCGACTCGTGCGGCTCTATGAAGCCTGCCTCGAGTCGGGACGGTTTCCGAAGCAGTGGAAGACGGGCAGACTTGTTCTGCTAAGGAAGGAGGGACGCCCCGCGGACTCACCTGCGGGATATCGTCCCATCGTGCTGCTGGACGAGGCTGGAAAATTGCTCGAGCGGGTGGTGGCCGCCCGCATCGTCCAGCATCTGACGGGGGTGGGTCCCGATCTGTCAGCGGAGCAGTTCGGATTCAGGGAGGGCCGCTCGACCATCGACGCGGTGATGCGCGTGCGTGCCCTCTCTGATGAGGCTGTCGGCCAGGGCGGGGTTGCACTGGCGGTGTCCCTTGACATCGCCAACGCGTTCAACACCTTGCCCTGGTCGGTGATCGCAGGGGCGCTGGAGTATCACGGCGTCCCTGCGTATCTCCGTCGGCTGATCGGGTCCTACCTCGAGGACAGGTCGGTCGTGTGCACCGGGCACGGTGGGGCGGTGCTCCGCTTCCCCGTCCAGCGCGGTGTTCCACAGGGGTCGGTCCTTGGCCCTCTCTTGTGGAACATCGGCTACGACTGGGTCCTGCGTAGCGCCCTTAGTGCTCCTCTTCCGGGTCTGAGCGTAGTTTGTTACGCGGACGACACTTTGGTCGTGGCCCGGGGGAGGGACTTGCGAGAGTCTGCCCGTCTTTCCTGCGCGGGGGTGGCCTTCGTCATCGGCAGGATCCGAAGGCTGGGTCTGGAGGTGGCGCTCGATAAATCCCAGGCCCTGTTGTTTCACGGGGCCCGGAGAGCGCCGCCTCAGGGGGCCCACCTCGTGATCGGAGGCGTTCGCGTCGAGATCGAGGCAACCGGGTTGCGGTACCTCGGTCTCGTACTGGACGGTCGTTGGAGCTTCCGCGCTCACTTTGAAAGATTAGGTCCCCGACTGATGGCGGCTGCCGGCTCGCTGAGTCGGCTGTTGCCGAACGTCGGGGGGCCTGACGTGGTGGTGCGCCGCCTCTACACGGGGGTGGTGCGGTCGATGCCACTGTACGGGGCTCCCGTGTGGTGCCACGCCCTGACCCGCGACAACGTTGCGGCGTTGCGACGTCCGCAGCGCGCGATTGCGGTCAGGGCGGTTCGTGGATACCGCACCGTCTCGTTTGAGGCGGCGTGCGTGCTAGCTGGGACGCCTCCCTGGGACCTGGAAGCGGAGGCGCTCGCTGCGGATTACGCGTGGCGATGCGATCTCCGCTCCAGGGGGGAGCCGCGTCCCGGCGCGGCGGAAGTTCGAGCGCGGAAGCTTCAATCTCGGCGTGCCGTGCTCGAGGCGTGGTCTCGCCGCCTGGCGGACCCCGCCTACGGGCGACGGACCGTCGAGGCGATCCGCCCGGTCCTCTCGGACTGGGTGAATCGCGACCGAGGACGTCTCACCTTCCGAGCGACGCAGGTGCTCACGGGACACGGCTGTTTCGGTCGCTACCTGCACCTCGTCGCCCGGAGGGAGCCGACGCCGAAGTGCCACCACTGCAGTGGCTGCAACGAGGACACGGTGGAGCACACGCTCGGGTACTGCACCGCTTTCGCGGAGCAGCGCCGCGTCCTCGTTGCAAAAATAGGACCGGACTTGTCGCTTCCGACCGTCGTGGCTACGATGCTCGGCAGCGACGAGTCCTGGCAGGCGATGCTCGACTTCTGCGAGTCCACCATCTCGCGGAAGGAGGCGGCGGAACGGGAGAGGGAGAGCTCTTCTTCCCTCTCGGCGCCGTGCCGCCGCCGTCGAGCCGGGGTTCGGAGGAGGGCGACTTGCTTTTCGGATGTAGAAAGTCACCGGAGATTGGAAAGCAGTCTTCGTCAGCGGACTGCAATCTCCAATCTACTTTTACTAGTAGTAGAGCATATTGAAATTGCCTATTTCTGCCGCGAAACCCGTGACACAGCCGTTTTAAAACGGAATTGGGACTTCAAGCTCATTCAAGCTCTAAAAGTGTAG
Protein
MLQIPWTAHQADASILRQLNIQTRLSAIRLKRISEFFGHIARKSDGNLEKLIVTGKIAGKRPSGHNPVQSEVSAVGPGRRRDPQHPICVLWVPSAEEMLDSYRARPTGRFVSRNKADPRTRRKRKTVKRPVTPALSDSSEIELAPAKFLAVEDGPADATGSSAKERGRQDLTVTYGESAVTTSVRTGAFRRKEAGLVREGEVERLTRSLTEVDTMDPRKAVEISLEIVSMVAAKSGSLKGTYVRALKCVAAAVEKLLDEFLRRTSTEEVTCLRSQLEQLLAENSELRAEGVRVREEMAEMRASLDGLLGQQGRLASPSPPSPSNERAENEKDKEIEELKRRIAILEARASKVERARPPLAHERQAPAPSPCDALAALSRTRAAGTRVGAAPSARASTKVAASNKPVGRRMAVQPVRPQADASAPLQPAKAGPGRSRKNTKGCVNAAQPAQRPQPRPLPPAPSNMEAAWTTVVKRGRRRALDVPSPRPVPTVNAPQVMGRAVTEGKRKGGRKARKPRAPRSAAVVLELLPAAKEKGLTYGEVMARARVSVDVDAMGVEGGLRVRHTANGARLLECPGANTSAVADRVAARLREILPDPELVRIDRPVKMAEIKVTGLDECATKEEVAAAIASQGNCALTQVKVGELRSSYSGAFTVWARCPMQAATLLATPPRGRPADSPGRLRVGWVIAHVQLQKARPWRCLRCFGTGHGLARCPSAVDRSGLCFRCGQPGHKAGSCTAAAPHCVLCDAAKRRADHRAGGPSCLSAPSSTKRRRGGKKKKNIEEGPAACDTAGRAQDLLVHTMAEWFIDIAIVAEPYFVPPDREDSWAGDVDGSVAIVMRQSAALPPLGMVARGSGYVVVRVNETVVIGVYFSPNRSLAEFERFLGGLEALVHRFESRPVILAGDLNAKCTAWGSPRTDSRGEFLSEWAFATGLCLLNRGSVATCVRWNGESHVDVSFASPSAARRVRGWRVLEGAETLSDHRFVRFELSVSTLLNAPDEDARGEEELPRSAPRSFPRWALKRLNKVLAVEAATVAAWAPLPARLVDVELEAEWFRGTMRRVCDAAMPRVSGRAPRGGAYWWTPEIALLREECVRARRRSARHRRRRLRDADFAEVATRLHADCRQKQEALRRAIGEAKSQSMKTLLETLDQDPWGRPYQTVRKKLRPWALPVTERLQPQQLREIVYGLFPRMERSFEPPSMGAPPRSSVSGRGPGPDGVHGRVWDLAFGALGDRLVRLYEACLESGRFPKQWKTGRLVLLRKEGRPADSPAGYRPIVLLDEAGKLLERVVAARIVQHLTGVGPDLSAEQFGFREGRSTIDAVMRVRALSDEAVGQGGVALAVSLDIANAFNTLPWSVIAGALEYHGVPAYLRRLIGSYLEDRSVVCTGHGGAVLRFPVQRGVPQGSVLGPLLWNIGYDWVLRSALSAPLPGLSVVCYADDTLVVARGRDLRESARLSCAGVAFVIGRIRRLGLEVALDKSQALLFHGARRAPPQGAHLVIGGVRVEIEATGLRYLGLVLDGRWSFRAHFERLGPRLMAAAGSLSRLLPNVGGPDVVVRRLYTGVVRSMPLYGAPVWCHALTRDNVAALRRPQRAIAVRAVRGYRTVSFEAACVLAGTPPWDLEAEALAADYAWRCDLRSRGEPRPGAAEVRARKLQSRRAVLEAWSRRLADPAYGRRTVEAIRPVLSDWVNRDRGRLTFRATQVLTGHGCFGRYLHLVARREPTPKCHHCSGCNEDTVEHTLGYCTAFAEQRRVLVAKIGPDLSLPTVVATMLGSDESWQAMLDFCESTISRKEAAERERESSSSLSAPCRRRRAGVRRRATCFSDVESHRRLESSLRQRTAISNLLLLVVEHIEIAYFCRETRDTAVLKRNWDFKLIQALKV

Summary

Uniprot
ProteinModelPortal
PDB
1WDU     E-value=6.9056e-09,     Score=151

Ontologies

Topology

Length:
1884
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.09082
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00002
outside
1  -  1884
 
 

Population Genetic Test Statistics

Pi
0.373352
Theta
1.399301
Tajima's D
-1.585944
CLR
26.524703
CSRT
0.0405479726013699
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号