SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06811
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 2.12
 

Sequence

CDS
ATGGTAAAGTCTAGCTTGCGACCAACTAGGCAACAAATCTTGGAGCCCCCAGATAACTTCCAATTGGAAGTCAAAAACAGGTTTGACGTGTTGGAAACTGACTGCGACGTGGATAAGCGCACCAACGAAATGGTGAAAATTCTAAGAGAAGTGGGCAATAAATACTTTCAGCATAGAAGAAAAGGCCAAGAGACTAAACTCTCCAACGAGACCCTGCTATTGATGAAACAGCGAAGGGAAACTGCAGATGCTACTCCGTCAGATGGAAAAACTATAAACACTAAAATCAGAAAGCTGATTAGGCGTGACCTTCGCCAATTCAACACAATAAAGATTAAAGAGGCAATACAACAAAACAAAGGCACCAAAGTGTTTATACGGCAACAACAACTAGGCCGAAGCCATCTGACGAAGCTCAAAACTGCCGATGGAAGAATTGTTGAATCAAGATCAGAAGTCCTCACTGAAGTGGAGAGCTACTATCGTAGTCTCTATGCCTCACAGGCTCCCAAGCCCTTTGCCCACCCAGAGATTGATCACCGAGCCCCCTTAGTCCGCCACTATACGGAAGACATACCCGACGTCAGTATAGAGGAGATAAGGGCTGCTTTGGAACAGCTTACAAATAACAGAGCTACAGGGGATGACGGAATCAGTGCAGAATTGTTGAAGGCAAGTGGTACATCAGTTCTCAACCAATTATGCACAACGTTCGACACTGTCATTCAAAAAACTACTACACCGGAAGCCTGGAGCAAGGGTACTGTCATTCTTTTCTTTAAGAAGGGAGACCGTGCTCTGCTCAAGAACTACAGGCCTATTTCACTTCTTAGCCATATTTATAAGCTGTTCTCGAGAGTCCTTACAAATCGCTTGGCCTCTAGACTTGACGAGTTCCAACCTCCGGAGCAGGCTGGGTTTCGCAAAGGCTATAGTACGGTAGACCACATCCACACGCTGAGACAGGTTATTCAGAAGACTGAAGAATACAATCGTCCTCTGTGTCTCGCATTTGTGGACTACGAAAAAGCCTTCGACTCCGTCGAAACTTGGGCTGTTCTGGAATCCTTACAGCGATGCCTAGTCGATTATCGGTACGTTGAGGTGTTGAAGAGTTTATACAAAGCCGCCAAAATGACAGTCCAGATCCAAAACCAGCAGACAAACCCGATTGAGCTTCACAGAGGGGTGCGACAGGGTGACGTTATATCGCCGAAACTGTTCACTGCTGCTCTCGAGGATGTCTTCAAGACTCTGGACTGGAGTAAGCTCGGCATCAATGTCAATGGCGAGTATCTCTCACACCTCCGATTTGCAGACGATATCGTTATGATGGCAGAGTCGCTGGAGGATCTCAGCTGTATGCTGGGTGAGCTGAATGCCGCGTCACGACGTGTTGGTCTAGGAATGAATCTGGACAAAACTAAGGTCATGTTCAACGACCATATCATTCCTGGACCGGTAATAGTCGAATCCGCGGTACTCGAAGTTGTGTCTGAATACACTTATCTAGGCCAAATTATTCAGCTAGGCAGGGCCAACTTTGAGAAGGAAGCTGATAGGCGCATACAGTTGGGTTGGGCTGCGTATGGAAAACTCCGTCATATCTTGAACTCAGGAATCCCGCAATGCCTAAAAACAAAAGTCTTCAACGCTTGCGTGCTGCCGGTCATGACATATGGCGCCGAAACGTGGACATTGACCGTAGGTCTAGTCCGTAAGTTCAAAGTCGCTCAGCGTGCTATGGAAAGGTGTATGCTCGGAGTTTCTTTGATGGATCGACTTAGAAATGAGGAAATCCGTCAAAGAACCAAAGTAACCGACATAGCCCTAAAGATTAGCAAGCTGAAATGGCAATGGGCTGGACATACGTGTCGCAGAACCGATGGGCGATGGAGCAGACGTGTTCTGGACTGGAGACCGCGTACCGGTAAGCGCAGCGTTGGGCGTCCCCCTGCCCGTTGGACCGATGACTTGCGGCGATATGCTGGGAGAGATTGGATGCGGAAGGCGGAGGATCGTTCATTGTGGCGGACTATGGGAGAGGCCTACATCCAGCAGTGGATAGATACAGGCTGA
Protein
MVKSSLRPTRQQILEPPDNFQLEVKNRFDVLETDCDVDKRTNEMVKILREVGNKYFQHRRKGQETKLSNETLLLMKQRRETADATPSDGKTINTKIRKLIRRDLRQFNTIKIKEAIQQNKGTKVFIRQQQLGRSHLTKLKTADGRIVESRSEVLTEVESYYRSLYASQAPKPFAHPEIDHRAPLVRHYTEDIPDVSIEEIRAALEQLTNNRATGDDGISAELLKASGTSVLNQLCTTFDTVIQKTTTPEAWSKGTVILFFKKGDRALLKNYRPISLLSHIYKLFSRVLTNRLASRLDEFQPPEQAGFRKGYSTVDHIHTLRQVIQKTEEYNRPLCLAFVDYEKAFDSVETWAVLESLQRCLVDYRYVEVLKSLYKAAKMTVQIQNQQTNPIELHRGVRQGDVISPKLFTAALEDVFKTLDWSKLGINVNGEYLSHLRFADDIVMMAESLEDLSCMLGELNAASRRVGLGMNLDKTKVMFNDHIIPGPVIVESAVLEVVSEYTYLGQIIQLGRANFEKEADRRIQLGWAAYGKLRHILNSGIPQCLKTKVFNACVLPVMTYGAETWTLTVGLVRKFKVAQRAMERCMLGVSLMDRLRNEEIRQRTKVTDIALKISKLKWQWAGHTCRRTDGRWSRRVLDWRPRTGKRSVGRPPARWTDDLRRYAGRDWMRKAEDRSLWRTMGEAYIQQWIDTG

Summary

EMBL
FJ265551    ADI61819.1    FJ265542    ADI61810.1    FJ265545    ADI61813.1    + More
FJ265550    ADI61818.1    FJ265549    ADI61817.1    FJ265544    ADI61812.1    FJ265543    ADI61811.1    RSAL01002130    RVE40575.1    RSAL01002362    RVE40503.1    MRZV01002136    PIK34564.1    KZ149985    PZC75698.1    AAGJ04050748    MRZV01000899    PIK42833.1    FJ265564    ADI61832.1    KZ150485    PZC70710.1    ODYU01004088    SOQ43598.1    KZ149907    PZC78256.1    FJ265561    ADI61829.1    KZ150317    PZC71439.1    KZ150108    PZC73382.1    FJ265562    ADI61830.1    GBBI01004876    JAC13836.1    JARK01001655    EYB84321.1    GBGD01000453    JAC88436.1    GBBI01004877    JAC13835.1    GDKW01001596    JAI54999.1    JARK01001677    EYB83168.1    EYB83167.1    JARK01000173    EYC41342.1    JARK01000388    EYC37469.1    JARK01001351    EYC23395.1    JARK01001340    EYC31295.1    JARK01001370    EYC16150.1    JARK01001639    EYB85201.1    JARK01001389    EYC11015.1    JARK01001362    EYC18843.1    EYC18844.1    JARK01001434    EYC02684.1    FJ265563    ADI61831.1    JARK01000347    EYC38051.1    JARK01000732    EYC35149.1    JARK01000460    EYC36749.1    JARK01001621    EYB86109.1    JARK01001354    EYC21986.1    JARK01001626    EYB85833.1    EYC30828.1    JARK01001438    EYC02111.1    DS268411    EFP03057.1    DS268581    EFO91764.1    JARK01001517    EYB93530.1    JARK01001565    EYB89683.1    JARK01001337    EYC34625.1    JARK01001676    JARK01001446    JARK01001433    EYB83199.1    EYC01126.1    EYC02928.1    JARK01001378    EYC13977.1    JARK01001736    JARK01001462    JARK01001379    JARK01001338    EYB80775.1    EYB98943.1    EYC13646.1    EYC33347.1    JARK01001568    EYB89432.1    JARK01001406    EYC07496.1    JARK01001348    EYC25050.1    MRZV01000249    PIK54411.1    EYC25048.1    JARK01001500    JARK01001343    EYB95040.1    EYC28825.1    JARK01001473    EYB97806.1    JARK01001630    EYB85641.1    DS268591    EFO92565.1    DS268453    EFP04265.1    JARK01001346    EYC26784.1    DS268444    EFP01729.1    JARK01001344    EYC28218.1    JARK01001349    EYC24735.1    JARK01000248    EYC39628.1    DS268655    EFO97114.1    JARK01001470    JARK01000204    EYB98082.1    EYC40602.1    JARK01000077    EYC43894.1    JARK01001380    EYC13322.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF01826   TIL
PF03372   Exo_endo_phos
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR036084   Ser_inhib-like_sf       
IPR002919   TIL_dom       
IPR029052   Metallo-depent_PP-like       
SUPFAM
SSF56219   SSF56219        + More
SSF57567   SSF57567       
Gene 3D
PDB
6AR3     E-value=0.0138876,     Score=93

Ontologies

Topology

Length:
692
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.26183
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00074
outside
1  -  692
 
 

Population Genetic Test Statistics

Pi
3.43189
Theta
15.002992
Tajima's D
-1.399399
CLR
27.703456
CSRT
0.0709964501774911
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号