SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06791
Annotation
PREDICTED:_uncharacterized_protein_K02A2.6-like_[Papilio_machaon]
Location in the cell
Nuclear   Reliability : 3.135
 

Sequence

CDS
ATGCCGATTGGGAAAGTTGAAAGTTTTGATATGGGATCTCAAAATTGGGACACATACATTCGTCGTGTAAAACAATTCATGGAACTCAACGACATTGAACAGAGACTTCACGTTGCAACGCTCGTAACCTTAGTTGGGTCTGAGTGCTATGACTTAATGTGTGACTTGTGTGCTCCGGACTTACCAGAAGAAAAGGATTTCGACATACTCGTAAAATTAGTCAAAGATCATCTAGAACCTGAAAGATCGGAAATAGCAGAACGTCATATCTTCAGGCAAAGAAAGCAGCAAAATAACGAAAGCATTCGTTCCTACCTACAAAGTTTGAAACATTTGGCTAAAACTTGCAATTTCGGCATCACATTAGAAATTAATCTACGCGATCAATTCGTATCAGGATTATATAGTGAGGAGATGCGATCAAGGCTGTTTGCTGAAAAAGATATAGATTACAAGCGCGCTGTTGAGTTGGCATCAGCACTGGAAGCAGCGGATCGACATGCGATGGCGGCTGGGGGCACTGGGGGCAGCTCACAGGCTGCGTCCGAGAGCGATGGCATGCATCGGGTCGGCGGAGCGCGCGCGGAGGCTCGCTGCGCCTGCAGACGCTGCGGCAAGCTGGGCCATGCGGAGGGTCGGTGTCGGTACAAGCACTACACCTGTGACTCATGTGGCGAGAAGGGACACCTAAAATCAATGTGTCGGAACCGTAAAGGTAACCAAAAGATTGAAAAAAACCGAGGTGGTGGTGAATATTACACAAAATTGGATTTATCTAATGCATTCCAGCAATGCCTCTTAGACGAAGAATCCCAGCCGATGACAGCGATCACGACACACATTGGTACTTTTGTCTATAAGCGCGTTCCGTTTGGAATTAAATGCATTCCGGAAAACTTTCAGAAGATTATGGAAGAGATTCTAAGTGGTCTGCCGTCAACCGTTATTTTTGCGGACGATATATGTGTAACCGGAAAAAACAGTTATATTCTTGGAAAGAATAAAGGTATACCTCTAACCGCCGCGAGTCGTCTGCAACGATTTGCTGTAAAGCTAGCTGCGTATGATTTTGAGATCGAATTTATTAGTTCTACAGATAATTGCCAGGCTGACGCGCTATCACGACTTCCACTGGATACTAATTTTAAGAATAATATTAAGGAGTATAATTACCTAAACTTCGTTCAAGAAAGCTTTCCACTCAGTTTTAAAGAAATTAAAAAGGAAGTTACGAAGGATCCTTTACTAAACAAAATTTACGGTTACGTCATGTTTGGCTGGCCCTCTGTCAGTAAAGAACAAGCAGAAAAACCCTATTTTAACAGAAGAGAATCCATACATATTGATCACGGTTGTCTTGTATGGGGTTACAGAATAATAATTCCAACTTCATTGCGAGAGACTGTGTTACAGGAGTTACATGAGGGACATCCGGGTATTGTTAAGATGAAACAATTAAGCCGGAACTACGTATGGTGGGAGACAGTCGATGCAGACATTGAACGTGTATGTGCTCAGTGCCAGGCCTGTCGATCTCAGCGCGCTGCACCACCATCGGTGCCGCTGCACTCGTGGCCATGGCCGGAAGAGCCGTGGGCGCGCCTTAATCTTGATTTCTTGGGACCGTTTAATAACAAATATTACTTAATTATAGTGGACGCTCATTCAAAATGGATCGAGGTGGAAAAATTGAGCTGTACATCAGCCACGGCAGTAATCGCATGTCTCAGACGATTGTTTGCTCGATTTGGCTTAGCAAAAAAGGTAGTAACTGATAACGGACCACCTTTCTCGTCGATCGAATTTAGAACATATTTAAGTAAAAACGGTATAAAACATTTACCGGTGGCTCCGTATCATCCATCTAGCAATGGTGCAGCGGAAAACGCCGTAAAAACCATAAAAAGAGTGTTGAAAAAGGCTTTAATTGAAAAGGAAGACGACAATACCGCCTTGACAAAATTTCTCTTTATGTACAGAAATTCTGAGCACAGCACTACAGGGCGCGAACCAGCAGTTGCTTTGTTCGGACGTCGCCTGCGTGGAAGACTGGATCTGTTGCGTCCAAATACTAGCTCCATAGTACGAGAAGCACAGCTGGCAAGCGAAAGCTATAATGCAGGCACAGCCGGATATAGGGAGGCGGCAGAAGGAGACTCGGTCCTATTGCAAGATTTCACACAGGGAAAAAAGAAATGGACCACAGGAACAATAAAAAACCGCTCAGGTCCGGTGACATACAGGGTAACAGCAGATGACGGGCGGGTACACAAACGTCACATCGACCAGATTTTAATAAGTAACAATAGTCGAAAATCACGTTATTCTTTGTCCAAATTAAACACTGATTTCGAGACAAAATCAGTAAATGATAGTGTGGGTGAAGTTCGGGAAAGTCCGTGTATGACCGGAGAAAAGGAGCTCAACTCCAGCTATGACACGGGACCGGAAAGTCCACAACCTGTGACTCCTAGTCACTCGCCGGCGCCGAATGTCTTGCAACCATCGCGTCAGCGCCGTAAAGCTGCTTTAACGTGTATTCAGAGAATTAAGGACCAAAATTACTAA
Protein
MPIGKVESFDMGSQNWDTYIRRVKQFMELNDIEQRLHVATLVTLVGSECYDLMCDLCAPDLPEEKDFDILVKLVKDHLEPERSEIAERHIFRQRKQQNNESIRSYLQSLKHLAKTCNFGITLEINLRDQFVSGLYSEEMRSRLFAEKDIDYKRAVELASALEAADRHAMAAGGTGGSSQAASESDGMHRVGGARAEARCACRRCGKLGHAEGRCRYKHYTCDSCGEKGHLKSMCRNRKGNQKIEKNRGGGEYYTKLDLSNAFQQCLLDEESQPMTAITTHIGTFVYKRVPFGIKCIPENFQKIMEEILSGLPSTVIFADDICVTGKNSYILGKNKGIPLTAASRLQRFAVKLAAYDFEIEFISSTDNCQADALSRLPLDTNFKNNIKEYNYLNFVQESFPLSFKEIKKEVTKDPLLNKIYGYVMFGWPSVSKEQAEKPYFNRRESIHIDHGCLVWGYRIIIPTSLRETVLQELHEGHPGIVKMKQLSRNYVWWETVDADIERVCAQCQACRSQRAAPPSVPLHSWPWPEEPWARLNLDFLGPFNNKYYLIIVDAHSKWIEVEKLSCTSATAVIACLRRLFARFGLAKKVVTDNGPPFSSIEFRTYLSKNGIKHLPVAPYHPSSNGAAENAVKTIKRVLKKALIEKEDDNTALTKFLFMYRNSEHSTTGREPAVALFGRRLRGRLDLLRPNTSSIVREAQLASESYNAGTAGYREAAEGDSVLLQDFTQGKKKWTTGTIKNRSGPVTYRVTADDGRVHKRHIDQILISNNSRKSRYSLSKLNTDFETKSVNDSVGEVRESPCMTGEKELNSSYDTGPESPQPVTPSHSPAPNVLQPSRQRRKAALTCIQRIKDQNY

Summary

Pfam
PF00078   RVT_1        + More
PF17921   Integrase_H2C2
PF00665   rve
PF17917   RT_RNaseH
PF03732   Retrotrans_gag
Interpro
IPR001584   Integrase_cat-core        + More
IPR036875   Znf_CCHC_sf       
IPR012337   RNaseH-like_sf       
IPR021109   Peptidase_aspartic_dom_sf       
IPR001878   Znf_CCHC       
IPR000477   RT_dom       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR041373   RT_RNaseH       
IPR005162   Retrotrans_gag_dom       
IPR032675   LRR_dom_sf       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF57756   SSF57756       
Gene 3D
PDB
3S3N     E-value=1.31522e-09,     Score=154

Ontologies

Topology

Length:
855
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00059
Exp number, first 60 AAs:
0.00018
Total prob of N-in:
0.00003
outside
1  -  855
 
 

Population Genetic Test Statistics

Pi
10.603958
Theta
21.414367
Tajima's D
-0.856454
CLR
295.078218
CSRT
0.164341782910854
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号