SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06755
Annotation
PREDICTED:_uncharacterized_protein_LOC105387844_[Plutella_xylostella]
Location in the cell
Mitochondrial   Reliability : 2.148 Nuclear   Reliability : 1.675
 

Sequence

CDS
ATGGTGCTCACACGGTCCGAGAAGATGAGGTCGTCACGCCTTGACCGGCCCGGCAACGAAGCTGTCTCGGGCTCAACTTTGCAAGACGCACAGCAACGAGCTGTGTCGGCCGCGCCGCGTTCGGGAGTGACGCAGGGACCGCCACCGATGGCGGCAACCTCCTCCCAGTCAACCGCGCCGCGTTCGGGAGTGACGCAGGGACCGCCACCGATGGCGGCACCCTCCTCCCAAGTGGAAAAGTGTCCGGGAGTGCCGCGGGGCTCACAAGCGATGCCCCCCTCCCGCCAAATATTGCCTACGCAATACTCGCCGGCGTCGCCAACGGGACCGAACAGCGGGGTCTGTCGTCGAGTGGTCAGACCTCCCAGCACCGCGACACCGGCAACAACTTCAGGCGACGCAGCAACGGAGAGCGTCGTATCCGCGAGCCAGAACAAGAAGGAGTCAGCGCTCGCGGCCAATCAAATAGTACACGGGTCCCACATCACGGACGCCGCTGCCAAAATCTCGACGACAGAAGAAGGCTCCACACTCCGCGACGGGATGGCGCCACCAGTACGAGGATCTTCAAGAAAGTCGAGTCAACAGTCACAACGGCTGTTGCTTATGGCGCGCCTCAAGGAAGAGCATCTTCGCGCCAAGGAAGAACAAGCCCGACTCCAAGCAGAGCTCGCCGCCGCCCGCATCTCAACATTAGAAGCCGAAGCGCTCGTTGAAGAGGAGGAAGATGCGCGCACAACACTCACGGAGGACGAGAACGAGCAATCACAGCGCATCGACACATGGCTCAGTCAGCAACGATCGATCGCGCTACACGGAGTCGAAGAAAGAGTAATGCAGCCAACACACGGATCACCAGCCACCATCGAGCAACCGCAACTGGAACTTCCCGCACCAATAGAACAGCTGAAGCTACCGGCCCCTGCAGCGGCACCGATTGCCGCACCTGTCGCACCGAAGAGCGACATCGCCGAACTAGCAGCTGCCATCGCGACGGCCGCCCGCCAAGCCAGGCCCGGACCATCGCATCGGTACTACGGGGAGCTTCCAGTGTACAGTGGATCGCATCAAGAATGGCTCTCCTTCAAGGTCTCCTACGCCGAATCAGCGGACAGCTTCAGCGCCGCAGAGAACACTGCGAGACTTCGGCGTACGTTGAGAGGAAGAGCAAGAGAAGCGGTCGAAAACTTGTTGCTGCATTACACCGAGCCCGCCGAGATCATGCGGACTCTAGAATCGCGCTTCGGACGTCCAGAAGCAATCGCCGCAACGGAGCTGGAACGACTGCGCGCGCTGCCACGCTGCACGGACACACCGAGGGACATCTGCGTATTCGCGAATAAGGTGAACAACGTCGTCGCCGCTCTGAGGGCCCTCGACCGCGTACATTACATGTACAACCCGGAGCTCACCAACATCACATCAGAGAAGCTGCCGTCCACTCTACGCCACCGCTGGTTCGAATTCTCAGCGACTCAACCGGCGGGAGAACCGGACCTCGTCAAGCTGTCGCGCTTCCTGCAACGCGAGGCGGACCTGTGCAGCCCATACGCACAGCCGGAGCCAGAGACGAGAGTGGAGAACACCAGCGGTCGGCGGAAGATGGTGAATACGCCTCAGAGGACGCACACCACGCAAGCGAAGGAAGAGAGGAAATGCGCAGCATGTCAGAAGCCGGGGCACATCCCACAAGATTGTCCCGAATTCAAGAGAGCAGCCGTCAGCGAGCGCTGGGATACGGCGAAGCGCGAAAATTTGTGTTTCCGGTGCCTACGGTTCCGGTCCCGGGGACACGTGTGTAAAAAGAAGAAGTGCGGCGTCGACAGCTGTGAACGCACGCACCACGAGCTGTTGCATAAGAAGCCAGCATGGCAGAAGCCGAAGGAAAAAGAAGAGGCGGTCACCTCGACGTGGGCCGCAAGAAGTGCGACAGCCTACCTAAAGATGGCGCCAATTACTGTTATCGGACCGGCGGGAGAAGCAGATACATGGGCCCTGCTGGACGACGGGTCAACGATCTCGCTGATTGACGAAGACTTCGCGAGACGAGTGGGCGCCAAAGGACCGATCGAACCCCTCTTCATCACTGCCATCGGAAATAACAAGATAGACGCAACACGCTCACGACGCGTCCCGCTGAAGCTATGCGGACGCACGGGGGAACCGCAAGAACTGAATCTACGGACAGTCAACGGCTTAAAATTAACACCACAGCGACTGAACATCGAAGTCCTCGCGTCGTGCCATCACCTCACCGACCTCCGCCATCACTTCAAAACGAGCTACGCCTCGCCGAAGATCCTGATCGGCCAAGACAACTGGCACCTGCTGGTGACGGAGGAGATGCGGACGGGACGACGCGATCAACCAGTGGCGTCTCGTACTCCGCTCGGGTGGGTCGTGCACGGAGCACACCCGGGAGGCAAGAGACAGCGCGTCAACTTCGTGGCACACGCGACGACGGCCGACGCGAACATGGACGAAGCCCTCAGGCACTACTTCGCGATCGAGGGACTCACCGTCGCCGCCAAGACGCCAAAGAATGACCCAGACGAGCGCGCGCTGAAGATCCTGAGAGAGACCACTCATCAGCAACCCGACGGCCGCTACGAGACCGCACTGCTGTGGCGTGAGGAGGGCCTGAAGATGCCCAACAATTTCGAAGCCGCGCTAAATCGCCTGACGTCCGTAGAGAAGAAACTGGAGAAGGATCCAAATTTGAAAGAGCGCTACAAGCAACAAATGGACGCACTGGTAGCGAAAGGGTACGCCGAAGTAGCTCCGTCAACGGGGACGAAGGACCGAACCTGGTACCTGCCGCACTTCGGCGTAACACATCCGATGAAGCCGGACAAGATTCGCATCGTGCACGATGCCGCTGCGAAGACCAGGGGGAAGAGCCTCAACGACTTCCTGCTCACCGGCCCGGACCTGCTGCAGTCTCTGCCTGGAGTGATGATGCGCTTCAGGCAGCACGCCGTCGCCGTCTCAGCGGACATCACGGAGATGTTCATGCAAATAGGCGTCCGAAGCGAGGACCGCGACGCGCTCCGGTACTTATGGAGGGAGGACCCTTCACAGGAGCCTACAGAGTACCGGATGAAATCTATAATCTTTGGCGCGACAAGCTCACCCGCGACCGCCATCTACGTGAAGAACGCCAACGCGGAGAAGTACCGACTGCAGTACCCGGACGCCGCCGACGCAATCGTACGCAACCACTATATGGACGATTACCTGGGAAGTTACCGGACAAGCGAAGACGCGATCAGAATCGCAAATGAGGTGAGGGCAGTACACCGGCAAGGCCATTTCGAGTTACGAAAATGGACCTCGAACAACGAGGAGGTACGGTGCCACATGACCGACGAAGCCCCACCTACAAGTGTGACGCTGTCCGATGGAACGGAAATAGAACGAGTACTTGGCCTGGTGTGGAGACCTGCTGAAGACGTCCTCGCCTTCAATCTGGACATGGCGCGAATCCCAAAAGAAGTCTTGGAGAGCAGCGCGCCTACGAAGAGACAGGCTCTGCGAATAATGATGTCCGTCTACGATCCCCAAGGCATCGCATCACCAGTCACTATCGGAGCGAAGAAGATCCTGCAAGAGACGTGGCGCCGAGGGACGGCGTGGGACTCCCCCCTCGATGAAGACCTCTGCGCGATGTGGAGAGAGTGGATCGACCACTTAAGACGCCTGCGCGGCGTCTCAGTGCCGCGCTGCTATCCCGGCTACTCAGACGCCGCCAACCTCCAGCTCCACACATACGTAGACGCCAGTGAGTCCGCCTACGCCGCCGCGTTATACTGGCGCGCCGAAATGCCCGACGGGGAGATCAGGACCTCCCTCGTACTCGCCAAAGCCCGAGTCGCGCCCTTGAAACTCACCTCGATACCGCGCCTCGAGCTACAAGCTGCCGTGATGGGCAGCCGCATGGCCGCGGCTGTCACAGAGGAACACGACAGAAAACCAGACGCAAGAGTGTTCTGGACAGACAGCGCCACCGTATTGACCTGGCTGCGAACGGGGTCGAGGTCGTATCGACCGTTCGTCGCTCACCGCATTGCAGCGATAGAAGAGAACAGCACTGTGGAGGAATGGCGCTGGGTCCCCACGAAGGAAAATGTCGCCGACGACGCCACTAGAGAGCTACCCGTCGGCTTTGAAAGAAACCACCGCTGGTTCATAGGCCCGGAATACCTAAGACGGCATCCGGATGATTGGCCCGTACAACGGACTGCAAGAAGGGCAGAAGAGACGGGTGAAGAGAAGTGCGCAATGCTCGCCGTGAGCAGAGAGAGCCTCGGCGAAGCGATCCCGGACCCAAGACGCTTCTCCAAGTGGGAGAAGTACCTGCGTGCAACGGGGCGAATACTACAATTCGTCAGCCTATGCCGCAGGAGTCGCGAGCGCACTCATTACAAGAGGACCAGACGGAACCCGCGTTCGGACCCGACGTGGGAGAAGAATAGAAAGAAGACGACTTCGAAGACCCCGCTGAACACACCGCGGACGCCAGAGCAAGCAGTCATTCAATGGAAGACTTTAGACGCCGACACGCTTCGACGCGCCGAGACGCTCATTTGGCGACAGAGCCAGCGGGCGGCCTTCGAGGAAGAGATTTTGACGCTCCAGCGAGGGAAACAAATATCCCCAGCGAGCCGACTGCGAAACTTGTCCGTAACCTACGCGGACGGGATATTAAGAATAAACGGACGCATCGGCAACATTAAGGGAGCTGACGTCATCACCTCGCCTCTCGTGCTAGACGGATCCCGACGCGAAACGAGACTGATGATAGACTTCATCCATAGAAAGATGCACCACGCCGGAACCGAAGCTACGATCGCCGAGTGCCGACAGTCGTACTGGGTTTTACGCCTACGCCCAGTGACACGGAGCGTAATCCACAACTGTCTTCCGTGTCGTATCCGCAAGGACACACCACCGCGTCCAGCCACGGGCGATCACCCACCGAGCAGACTGGCACACCATCGGCGACCATTTACATACGTGGGCCTCGATTACTTCGGGCCCTATCAAGTTACCACCGGCAGAAGCACCCAGAAGCACTACGTGGCCATCTTCACATGTCTCACTACGCGTGCGGTACATTTAGAACCGGCAGCGAGCCTCAGCACAGACTCAGCGGTGATGGCACTCCGGCGCATGATCGCGCGCCGGGGAGCCCCGACGGAGATATGGAGCGACAACGGCACCAATTTACGGGGTGCCGACAAGGAGCTGCGCCAAGCTTTGGACAAGGCGACTGAGCATGAAGCGAGCTTAAGAATTATCCAATGGCGCTTCATCCCACCGGGCGCGCCTTTCATGGGCGGCGCCTGGGAAAGAATGGTACGGGCAGTAAAGGCCGCGCTCTCGGCCACGGAGCAGCCGAGGCACCCGACGCCCGAAATATTTCACACTCTGCTAGCGGAGGCAGAGTTCACAGTGAACAGCCGACCTCTCACCCACGTATCGGTGAGCGCCGACGATCCCGACCCTCTGACACCGAACCACTTCCTGCTGGGAGGCCCGGCGCGAGTCCCCGTGCCGGGCAAGTTTGACGACGCCGACCTCATAGGGCGCGCACACTGGCGCGCAGCTCAACGTCTGGCAGATGTGTTCTGGAGTCGCTGGCTCCGGGAGTACCTGCCCGACCTGCAGAACCGGCGGGAGCCCCACAGCCGCGGGCCCGCCCTGAAGATAGGCGACGTCGTGATAATAGCAGACGGAACGCTCCCACGGAACACCTGGCCACGTGGGATCATCCAGGAGGTTTACCCGGGGGCCGACGGCATCACTCGAGTGGTCGACGTGCGCACCGCCGGCGGTATATTGCGACGCCCGGCAAAGAAGATTATCGTGCTGCCCACGATGACCGCCGCTCACCAGGGAGGATGCAGCGACGTGAACGACGCTGCACGGCGGGAGGATGTTCGCGACGGACATGAATAA
Protein
MVLTRSEKMRSSRLDRPGNEAVSGSTLQDAQQRAVSAAPRSGVTQGPPPMAATSSQSTAPRSGVTQGPPPMAAPSSQVEKCPGVPRGSQAMPPSRQILPTQYSPASPTGPNSGVCRRVVRPPSTATPATTSGDAATESVVSASQNKKESALAANQIVHGSHITDAAAKISTTEEGSTLRDGMAPPVRGSSRKSSQQSQRLLLMARLKEEHLRAKEEQARLQAELAAARISTLEAEALVEEEEDARTTLTEDENEQSQRIDTWLSQQRSIALHGVEERVMQPTHGSPATIEQPQLELPAPIEQLKLPAPAAAPIAAPVAPKSDIAELAAAIATAARQARPGPSHRYYGELPVYSGSHQEWLSFKVSYAESADSFSAAENTARLRRTLRGRAREAVENLLLHYTEPAEIMRTLESRFGRPEAIAATELERLRALPRCTDTPRDICVFANKVNNVVAALRALDRVHYMYNPELTNITSEKLPSTLRHRWFEFSATQPAGEPDLVKLSRFLQREADLCSPYAQPEPETRVENTSGRRKMVNTPQRTHTTQAKEERKCAACQKPGHIPQDCPEFKRAAVSERWDTAKRENLCFRCLRFRSRGHVCKKKKCGVDSCERTHHELLHKKPAWQKPKEKEEAVTSTWAARSATAYLKMAPITVIGPAGEADTWALLDDGSTISLIDEDFARRVGAKGPIEPLFITAIGNNKIDATRSRRVPLKLCGRTGEPQELNLRTVNGLKLTPQRLNIEVLASCHHLTDLRHHFKTSYASPKILIGQDNWHLLVTEEMRTGRRDQPVASRTPLGWVVHGAHPGGKRQRVNFVAHATTADANMDEALRHYFAIEGLTVAAKTPKNDPDERALKILRETTHQQPDGRYETALLWREEGLKMPNNFEAALNRLTSVEKKLEKDPNLKERYKQQMDALVAKGYAEVAPSTGTKDRTWYLPHFGVTHPMKPDKIRIVHDAAAKTRGKSLNDFLLTGPDLLQSLPGVMMRFRQHAVAVSADITEMFMQIGVRSEDRDALRYLWREDPSQEPTEYRMKSIIFGATSSPATAIYVKNANAEKYRLQYPDAADAIVRNHYMDDYLGSYRTSEDAIRIANEVRAVHRQGHFELRKWTSNNEEVRCHMTDEAPPTSVTLSDGTEIERVLGLVWRPAEDVLAFNLDMARIPKEVLESSAPTKRQALRIMMSVYDPQGIASPVTIGAKKILQETWRRGTAWDSPLDEDLCAMWREWIDHLRRLRGVSVPRCYPGYSDAANLQLHTYVDASESAYAAALYWRAEMPDGEIRTSLVLAKARVAPLKLTSIPRLELQAAVMGSRMAAAVTEEHDRKPDARVFWTDSATVLTWLRTGSRSYRPFVAHRIAAIEENSTVEEWRWVPTKENVADDATRELPVGFERNHRWFIGPEYLRRHPDDWPVQRTARRAEETGEEKCAMLAVSRESLGEAIPDPRRFSKWEKYLRATGRILQFVSLCRRSRERTHYKRTRRNPRSDPTWEKNRKKTTSKTPLNTPRTPEQAVIQWKTLDADTLRRAETLIWRQSQRAAFEEEILTLQRGKQISPASRLRNLSVTYADGILRINGRIGNIKGADVITSPLVLDGSRRETRLMIDFIHRKMHHAGTEATIAECRQSYWVLRLRPVTRSVIHNCLPCRIRKDTPPRPATGDHPPSRLAHHRRPFTYVGLDYFGPYQVTTGRSTQKHYVAIFTCLTTRAVHLEPAASLSTDSAVMALRRMIARRGAPTEIWSDNGTNLRGADKELRQALDKATEHEASLRIIQWRFIPPGAPFMGGAWERMVRAVKAALSATEQPRHPTPEIFHTLLAEAEFTVNSRPLTHVSVSADDPDPLTPNHFLLGGPARVPVPGKFDDADLIGRAHWRAAQRLADVFWSRWLREYLPDLQNRREPHSRGPALKIGDVVIIADGTLPRNTWPRGIIQEVYPGADGITRVVDVRTAGGILRRPAKKIIVLPTMTAAHQGGCSDVNDAARREDVRDGHE

Summary

EMBL
AF530470    AAQ09229.1    RSAL01000375    RVE42106.1    KQ459986    KPJ18861.1    + More
LNIX01000007    OXA52015.1    LNIX01000004    OXA55241.1    LNIX01000019    OXA44855.1    LNIX01000015    OXA46575.1    LNIX01000003    OXA57597.1    JXUM01136032    KQ568367    KXJ69026.1    JXUM01127084    KQ567147    KXJ69602.1    GEZM01052586    JAV74401.1    LNIX01000039    OXA39294.1    GDHC01018323    JAQ00306.1    GAMC01017930    JAB88625.1    LN877231    CTR11689.1    JXUM01111221    KQ565482    KXJ70922.1    JXUM01130316    KQ567562    KXJ69370.1    GGFL01001682    MBW65860.1    GEHC01000967    JAV46678.1    OXA55408.1    GGFL01001842    MBW66020.1    JXUM01038372    KQ561162    KXJ79503.1    OXA56382.1    GGFJ01000306    MBW49447.1    GGFJ01000333    MBW49474.1    GEHC01000913    JAV46732.1    GEHC01000947    JAV46698.1    GEHC01000921    JAV46724.1    GEHC01000945    JAV46700.1    AB110069    BAD01590.1    BAD01589.1    GGFL01005193    MBW69371.1    GGFJ01000218    MBW49359.1    KL367480    KFD71819.1    GGFJ01000302    MBW49443.1    AAGJ04040339    AAGJ04043389    AAGJ04001285    AAGJ04058558    AAGJ04115911    AAGJ04091218    AAGJ04095911    GDIP01036233    JAM67482.1    GDIP01004568    JAM99147.1    JYDO01000040    KRZ75294.1    JYDP01000296    KRZ01365.1    GGFJ01000432    MBW49573.1    KRZ75306.1    GGFJ01000487    MBW49628.1    GGFJ01000471    MBW49612.1    GGFJ01000470    MBW49611.1    GDIP01030392    JAM73323.1    NSIT01000285    PJE78034.1    GDIQ01002920    JAN91817.1    LSMT01001301    PFX12555.1    GDIQ01002921    JAN91816.1    JYDK01000180    KRX73317.1    JYDL01000119    KRX15895.1    JYDL01000102    KRX16693.1    JYDI01000333    KRY45736.1    JYDT01000182    KRY82272.1    JYDP01000218    KRZ02721.1    JYDJ01000536    KRX34640.1    GCES01095441    JAQ90881.1    JYDH01000144    KRY30334.1    KL367558    KFD64244.1    JYDN01000258    KRX52286.1    JYDT01000008    KRY92224.1    AAGJ04094839    JYDU01000375    KRX86446.1    JYDS01000555    KRZ02797.1    LSMT01000554    PFX16342.1    JYDM01000410    KRZ82006.1   
Pfam
PF03564   DUF1759        + More
PF05380   Peptidase_A17
PF00665   rve
PF18701   DUF5641
PF05585   DUF1758
PF17921   Integrase_H2C2
PF01565   FAD_binding_4
PF09129   Chol_subst-bind
PF00628   PHD
PF00078   RVT_1
PF01048   PNP_UDP_1
PF13855   LRR_8
PF18738   HEPN_DZIP3
PF14943   MRP-S26
PF00271   Helicase_C
PF00270   DEAD
PF17919   RT_RNaseH_2
Interpro
IPR040676   DUF5641        + More
IPR036397   RNaseH_sf       
IPR005312   DUF1759       
IPR001584   Integrase_cat-core       
IPR008042   Retrotrans_Pao       
IPR012337   RNaseH-like_sf       
IPR041588   Integrase_H2C2       
IPR008737   Peptidase_asp_put       
IPR001995   Peptidase_A2_cat       
IPR001878   Znf_CCHC       
IPR006094   Oxid_FAD_bind_N       
IPR016166   FAD-bd_PCMH       
IPR016164   FAD-linked_Oxase-like_C       
IPR016170   Cytok_DH_C_sf       
IPR015213   Cholesterol_OX_subst-bd       
IPR036318   FAD-bd_PCMH-like_sf       
IPR016169   FAD-bd_PCMH_sub2       
IPR016167   FAD-bd_PCMH_sub1       
IPR011011   Znf_FYVE_PHD       
IPR013083   Znf_RING/FYVE/PHD       
IPR001965   Znf_PHD       
IPR019787   Znf_PHD-finger       
IPR019786   Zinc_finger_PHD-type_CS       
IPR002999   Tudor       
IPR001841   Znf_RING       
IPR000477   RT_dom       
IPR000253   FHA_dom       
IPR021109   Peptidase_aspartic_dom_sf       
IPR003961   FN3_dom       
IPR035994   Nucleoside_phosphorylase_sf       
IPR000845   Nucleoside_phosphorylase_d       
IPR032675   LRR_dom_sf       
IPR001611   Leu-rich_rpt       
IPR041249   HEPN_DZIP3       
IPR003591   Leu-rich_rpt_typical-subtyp       
IPR027417   P-loop_NTPase       
IPR026140   MRPS26       
IPR013026   TPR-contain_dom       
IPR011545   DEAD/DEAH_box_helicase_dom       
IPR019734   TPR_repeat       
IPR001650   Helicase_C       
IPR011990   TPR-like_helical_dom_sf       
IPR014001   Helicase_ATP-bd       
IPR041577   RT_RNaseH_2       
SUPFAM
SSF53098   SSF53098        + More
SSF56176   SSF56176       
SSF55103   SSF55103       
SSF57903   SSF57903       
SSF53167   SSF53167       
SSF52540   SSF52540       
SSF48452   SSF48452       

Ontologies

Topology

Length:
1986
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00123
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00000
outside
1  -  1986
 
 

Population Genetic Test Statistics

Pi
33.241527
Theta
42.076695
Tajima's D
-0.676674
CLR
0.612647
CSRT
0.206139693015349
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号