SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06739
Pre Gene Modal
BGIBMGA012135
Annotation
PREDICTED:_uncharacterized_protein_LOC105842699_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.197
 

Sequence

CDS
ATGTTTTTAGAAAGATATCATGACTATGCAGTACTATTATTACAAGAAATAATGCCACGGGAGATTGCTTTTGATGGAACACTATCAATATGCAACCCTTGCTGGCTGAGATTTTATCGCGCAGTGCAAGTCCGGCCAGTAGACGATCCATTACCTCAGCAAGTTCAAGAACCACTTAATGAGCAAATACCTCTTCATGAAAACTTTAATAGTGCTCATGTTCTCGATATTATCGAGCTGTATGAATGGAGATTGGAACGAGGAACTCAGTTGGACTTCGAAAATGTTGAGGAGATAGATGACAATGAACTACATTTTTATACGGGTATGGATAAAATTCAATTCAATAATATTTTGAATCAAACATCTTCTCTACGTGATAGAACCAACAGTTCTGCTACTGTTTTGGGACTGTATTTAGTTAAAATAAGAACAGGTGAACCAGACGAGCGTATAGCTTCTATGTTTAATATGTCGAGAAGAACATTGGTACGAAAACTAAAAATAGCTCGAGAATGTTTATCTGAAGAGTTTGTTCCCCGCCATCTGGGTTTGGATCACATGACGAGAGAAGATGTAGTAGCTCGCAACTTAACCATCCCGAGTCATATTTTTGGAGGTAACCAGAATGAACCTGCGGCCATTCTTGTGTGTGTGATGGAACATACATATACGTGCAAAAAAGCTCCAACTTCCTTTTTCAGAGAAGAACGTATAGCCTGCACAAATTCCGCAACTTAA
Protein
MFLERYHDYAVLLLQEIMPREIAFDGTLSICNPCWLRFYRAVQVRPVDDPLPQQVQEPLNEQIPLHENFNSAHVLDIIELYEWRLERGTQLDFENVEEIDDNELHFYTGMDKIQFNNILNQTSSLRDRTNSSATVLGLYLVKIRTGEPDERIASMFNMSRRTLVRKLKIARECLSEEFVPRHLGLDHMTREDVVARNLTIPSHIFGGNQNEPAAILVCVMEHTYTCKKAPTSFFREERIACTNSAT

Summary

Pfam
PF13613   HTH_Tnp_4        + More
PF13359   DDE_Tnp_4
PF13843   DDE_Tnp_1_7
Interpro
IPR029526   PGBD        + More
IPR007527   Znf_SWIM       
IPR027806   HARBI1_dom       
IPR027805   Transposase_HTH_dom       

Ontologies

Topology

Length:
246
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00641999999999999
Exp number, first 60 AAs:
0.00537
Total prob of N-in:
0.05310
outside
1  -  246
 
 

Population Genetic Test Statistics

Pi
232.443993
Theta
137.584372
Tajima's D
1.967779
CLR
0
CSRT
0.881505924703765
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号