SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06737
Annotation
PREDICTED:_uncharacterized_protein_LOC106708887_[Papilio_machaon]
Location in the cell
Nuclear   Reliability : 1.619 PlasmaMembrane   Reliability : 1.504
 

Sequence

CDS
ATGTCGGTATCCTACATTCGCGGGAAGGTGACTAGTGAGCTCCGATGGTTCGCATCAGCTCATGCTTTGATTGACAGAACAGATAGGGATGCGGCATTGCTCGATAGGGCGTCTCAGGTGCACGAACGGTTGGAGGTAGTGTACGATCGGTTGTCTGACCTCGTTGCTTTGGGGTCCGAAGTGGAGAAGGAGGTGATCCATGCCATCGGTCTTGACGTGGACCAGTGTCAGGAGTACGCTGATGCCATTCTGCAACGGGTGGCCGATATTAAGAAGCAGTCGTCATCCGGTGGTAATGGAGGTTCGGGAACTACGTCAGGCGTCATATCACGCCTCCCCTCCATCGACCTGCCGATCTTCCACGGTGATCTGAACGAGTGGGTCGGCTTTATAAATTTGTTTGACAGCCTGGTCCATGGTCGGTCGGACTTGACTGCCTCTTATAAGATGGCTCAGCTTCGGGGTGCTCTGCGAGGTGAACCTGGTGAATTGGTGGCACACTTGCCTATCACCAACGACAATTATGCGGTCGCACGCCAGATCCTTTTCGACCGATATCAAAATCAACGACGGTTGGTAGACGCTCAGCTGGCCAGGCTGTTTGCGATACCCAAACTTTCTCGGGCGTCCGATATCAGAACCGAGGTACTGAATCCAGTTACGGTGGCTACTAAGGCCTTGGGCAATTTGGGTCTACCAGTAGACCAATGGTCATATCTGCTCTTTTATATTGTTGCAGGTAGGCTGCCGGTTGAGGTGCTCACTCGCTTCGAGCAGCAGGACAACGCAGGTAGGGACGAACTGCCTACCCTGGCCAATCTGCTGGCATTTTTAGAAGCCGAAAGTCGCAGACACGAGATTATGCCACCACCCTCCTCCTCTGGGTCGCGTGTGCCGGCTTCCGGCCACGCCGTTTCGGTTGCTCAGAGGGGAGGGGGAGGGGATAAGAGGGGGCCGTCTCAACGACTGACTGCGCTCATGGCAGCGGTGGGAGGCCCACGGTGTGCCTTCTGTCATGAGAGCGGGCACGACGTAGCCACCTGTCCGAGGTTCCGGTCGACGCGCATCAGGGGTAGACGCAACATCGTTGCCCAGCGGCGATGGTGCTTTTTTTGTTTTGGGCCGCACACGGCGAGCGTCTGTCCACAGCCACAATTGTGCCCTAATTGCGACGGTCGGCACCATGCCCTCCTGTGTCTGGAGTCTGCCGCCACTCCGAGGTCATCCGGATGCAGTCATCCAGCCTCGCCGACCGGTGAGCGCACCGGTCGTAGCCCTCGCCAATTCGGCGGCGTGGACCCTCGGGAAGAGGCTTCGCAGGGAGGCGTCGGGTTGGGTACTGCGGGTGGGTGCCAGCGGATGCCCACTAGCTACGCCGGGGTGGCCACGTTGTCCCCCCGTGCGGGGCCGTGTTCGCCTGCTGGATCGAGTAGCCCTGCTCACTCGTCTCCCCTTCCCTCAGAAGTACGGTTTTCCCCTCCGCTGAGGGAGCGGCCGACGCTGGAGCGACTCCCTCCAGTGTTTGGCCCGTTTGGCCATCGTACACGGAGTGTTGCCCCAGCCCCAGAAGCTGTTTTACTTCCTACCGCTTCTGTTCGGGTGTTGGATTCGGATGGCAACACTGTGTTTGCTCGAGCTCTGTTGGATTCCGGCGCACAGGGCAGTATTATGTCGAGCAACCTTGCAGTACGGTTGGGCAATCCTATTTACAAGTCTTCTTATTCTATTCGTGGAGTGGGCAATGTTAGAATTTCGGACGTGATCGGTCACACTTCATTTATTTTCTCATCGAATCCCAACCCTCGCTTACAGTTTAGAGTCTCAGCTTTGGTGATGCCTGAGGTGATAGGTCGTCACCCTCCGGTGAAGGTAAACAGTTACATACGGTCATTGACTTCAGACTTACGGCTAGCGGACCCCAAGTTTGACACCCCGGGGCCAGTAGACGTACTACTTGGGGCGGATGTACTAGGGAAGCTGCTCCTGACTGGGAAGCGCGTTCTTCATGCGGAGGGTTTGGTTGCAATGGACACAAAATTAGGGCATGTATTGTTGGGTCCTGCGTTCCGGCCGGTCGCTGCGAGGAAATCGGACAATTTTCTGGTCGGGTCTACGCTTTCGGAAGTAGTCCAACGGTTTTGGGAACTAGAAGAACCTCCTACAGCTTATCGAGTTAACCCGGATGAGGAGGAATGTGAGCTGTTTTACCAGAATAATACGGGTCGTCTCTATTCGGGCCGGTTCTTGTTAAGACTTCCTTTTCGGGCGAATCGCCCACTGCTAGGCAGTTCGAGGAAGGCAGCAGAGACTAGACTTTTGTCAATGGAGAGACGCATGAGGCGCGACGCGGTGTTCCGGCAGAAATATATAGAGTTTATGCGGGAGTATGAATCCTTAGGTCACATGTCGGTTTCCAAGGTAGATTGGAGTGCTACAGAGCACTGTTTCCTGCCTCATCATGCGGTTTTGAAAACTCCTAACGGGAAAATTAGGGTCGTGTTTGACGGTTCGGTCACGACCTCCTCCGGCGTCTCGTTAAATCAGTGTCTCCATTCGGGTCCAAAGCTGAACCGGGACATTTCAGACATACTGACGAGCTTCCGCCGGCACCAGATCGTTTTCGTGGCAGACATCCGTATGATGTTCAGGCAAACGGTGATTCATCCGGAGGATAGGCGGTATCAACTCATTCTCTGGCGTGAAAGCTCAGATGAGCCCATAAAAATTTATGAACTGAACAGGAACACTTACGGGTTGCGGTCGAGTCCATATTTGGCGGTTCGTTCTTTGCGGGAGCTGGCAGTGAGGGAACGGTTGCACTACCCTCGTGCTGCGGACATTTTGGAACGGGACCTATATGTCGATGACGTATGTACGGGCGCCGACAGTGTCGAAGAGGCCTTATCACGCAAGGATGAACTGATCCGCCTTTTGAGCAGGGGCGGGTACGAGTTGAGAAAATGGCTGTCTAACTGTCCTGAGTTGTTGACTGGTTTGCCAACGGAGTTTCAACAGGATCCCCATCTTTTCGAGAATGTCGATAACCCTAACATGCTGTCGGTCCTAGGGATTCAATATCGTCCGATTCAAGACGAATTTACCTATCGGGTGGAGTTGGAAAATCCAAAGGTATGGTCTAAGCGAACGGTGCTTTCCACAATTGCTCGAACCTTCGATCCAAACGGTTGGATCGCTCCTGTCACTTTTCTCTTAAAGTGCTTCATGCAGCGACTGTGGTCTGCTAACCTGTCATGGGACGAGGGGATTGCTGGTGACCTATTGAAGGATTGGTTGAACTTTTTCTCGTCTCTCCCTGATATTAACCACGTGTCAATACCTCGGAAGCTGGTTCCTGCGGGCAAATACAAGGCGTCTCTCCACGGGTTTTCGGATGCCTCGGAACGCGGATTCGCAGCTGCGGTATACTTGCGAACGGTTTCTTCAACTGGAAGGGTTGATATACGGTTGGTGTTAGCTAAGAGTAAGGTCGCTCCGCTTCGGACACGCATGACGATTCCGAAGCTCGAGTTGTCTGGTGCCGCTCTGTTGACTAGGTTGTTAAACCATACAGCTACTAGTTTACGGTCGGTTATTGATTTAGAAAACACTGTCTATGCTTGGACAGACAGCCAGATAGTGTTGTGCTGGTTGAAGGCTTCGGTTCATACACTTGAAGTTTTCGTGGCCAACCGTGTCTCCCAGATTCAAGGTTCTGAGGTCCCTCTAACATGGAGACACGTGCCTGGTGAGCTCAATCCGGCGGACTGCGCTTCTCGGGGATGCTTAGCATCGGAAATAGTTGATCATCAGTTATGGTGGGGTCCCCAGTGGCTCACCAAGAAAGCTTCTCAGTGGCCTCCCTCTCGCATAGAAGTTCCTCCAGGTCTCGTGGCTGCACCGGCGCAGTTCGAGGATCGAGGAGTGATTCAGGGGTTGGATTTGGATCTGCTCATCAACCGTTATAGCTCCTTGGACAAGCTGGTTAAGGTTACCGCCTGGATTTTGAGGTTTATTCGGAATTGTCGTTTGTCGGTGTCTCAACGCAATATGACACCTGTTGTGTGTCCCATCGAGCGGAAGAAGGCGCTGCTGAAATTAATTGAAGTTGTGCAAGCCACCAGCTTTCATTCAGAATTGAAGGCGCTAAGGACTAAGCGCCCTAAGCTTCGTGGAGCTATCGCTCGTCTTAGCCCCTTTGTAGACGGCCAGGGGCTGATTCGAGTGGGAGGTAGATTAAGTAACTCCAATTTACCTTATTCGGCGCGCCATCCTCTTTTACTTCCCAAGAAGAGCCAGTTAGTTGACCTGTTGGTGATGGATCGCCACATCGCAAATTCGCATTCCGGTTGCAATGCGCTGTTGGCATCCCTCCAGAGGGAATTTTGGATTCTGTCAGGGCGTCGTACGGTTCGGAGCGTCCTTTTCCGGTGTTTACCCTGTTATCGGCTTAAGGCGTCTACGATGCAGCCTCAGATGGGAGATCTGCCTCCAGACAGAGTGAAGAAGATGAGGCCGTTTTCTGGAGTTGGTACGGACTTCGCTGGGCCTTTCATGATCAAGGCTTCACGTTTGCGGAATGTTAGGTTAATTAAGGCTTATCTGTGCGTTTTTGTCTGCCTTTCAACCAAAGCTGTACATCTTGAAGTTGTTGCCGACCTTACAATTGAAGCCTTTATTGCGAGCTTGGATAGATTTGTGTCCCGTCGAGGCTTACCCGAATTGATACGCTCCGATAACGGAACGAATTTTGTAGGTGCGGACCGTTACTTGCGGGATGTAGTAAATTTCTTGAACAATAACCAGGTGGATATTGAAACGGCCCTCTCTCGTCGCGGTATTCGGTGGACCTTCAGTCCTCCAGGATGCCCCCACTGGGGTGGAATTTTCGAGGCAGTAGTAAAATCGGCTAAGACTCACTTGATGCGCGTGATAGGGCAAACCTCGCTCACCTTTGAGGAGTTAACTACGGTATTTTGTAAAATTGAAGCGGTACTTAATTCGCGGCCGTTGTGCCCGCTCAGTTCAGACCCGAATGACTTGGAGTCGTTAACTCCAGGCCATTTCTTGATAGGACAGCCACTCAATGCGTTGCCGGAGTATCCCCTCTCGGATATCAAGCCTGGACGGTTGAGGCGATACCAGATGTTGCAGCAGATGTCCCAAGATTTTTGGAAACGTTGGTCCCTTGAGTATTTACATCTGCTCCAGCAGCGCTTTAAGTGGACGGATAGAACCAGTCCCCCTCACGTCGGTGACCTTGTGTTGGTTAAGGATGCTAACCTGCCGCCACTGCGTTGGCGTAGGGGGCGCATTGTTAATCTGTTTCCCGGTAAGGATGGGACCCCTCGGTCTGCAGAGGTTCTGGTCGGGGACTCGGTTCTCAAACGAGCGGTCACAACGTTGTCCCGGCTGCCAGTTGATTAG
Protein
MSVSYIRGKVTSELRWFASAHALIDRTDRDAALLDRASQVHERLEVVYDRLSDLVALGSEVEKEVIHAIGLDVDQCQEYADAILQRVADIKKQSSSGGNGGSGTTSGVISRLPSIDLPIFHGDLNEWVGFINLFDSLVHGRSDLTASYKMAQLRGALRGEPGELVAHLPITNDNYAVARQILFDRYQNQRRLVDAQLARLFAIPKLSRASDIRTEVLNPVTVATKALGNLGLPVDQWSYLLFYIVAGRLPVEVLTRFEQQDNAGRDELPTLANLLAFLEAESRRHEIMPPPSSSGSRVPASGHAVSVAQRGGGGDKRGPSQRLTALMAAVGGPRCAFCHESGHDVATCPRFRSTRIRGRRNIVAQRRWCFFCFGPHTASVCPQPQLCPNCDGRHHALLCLESAATPRSSGCSHPASPTGERTGRSPRQFGGVDPREEASQGGVGLGTAGGCQRMPTSYAGVATLSPRAGPCSPAGSSSPAHSSPLPSEVRFSPPLRERPTLERLPPVFGPFGHRTRSVAPAPEAVLLPTASVRVLDSDGNTVFARALLDSGAQGSIMSSNLAVRLGNPIYKSSYSIRGVGNVRISDVIGHTSFIFSSNPNPRLQFRVSALVMPEVIGRHPPVKVNSYIRSLTSDLRLADPKFDTPGPVDVLLGADVLGKLLLTGKRVLHAEGLVAMDTKLGHVLLGPAFRPVAARKSDNFLVGSTLSEVVQRFWELEEPPTAYRVNPDEEECELFYQNNTGRLYSGRFLLRLPFRANRPLLGSSRKAAETRLLSMERRMRRDAVFRQKYIEFMREYESLGHMSVSKVDWSATEHCFLPHHAVLKTPNGKIRVVFDGSVTTSSGVSLNQCLHSGPKLNRDISDILTSFRRHQIVFVADIRMMFRQTVIHPEDRRYQLILWRESSDEPIKIYELNRNTYGLRSSPYLAVRSLRELAVRERLHYPRAADILERDLYVDDVCTGADSVEEALSRKDELIRLLSRGGYELRKWLSNCPELLTGLPTEFQQDPHLFENVDNPNMLSVLGIQYRPIQDEFTYRVELENPKVWSKRTVLSTIARTFDPNGWIAPVTFLLKCFMQRLWSANLSWDEGIAGDLLKDWLNFFSSLPDINHVSIPRKLVPAGKYKASLHGFSDASERGFAAAVYLRTVSSTGRVDIRLVLAKSKVAPLRTRMTIPKLELSGAALLTRLLNHTATSLRSVIDLENTVYAWTDSQIVLCWLKASVHTLEVFVANRVSQIQGSEVPLTWRHVPGELNPADCASRGCLASEIVDHQLWWGPQWLTKKASQWPPSRIEVPPGLVAAPAQFEDRGVIQGLDLDLLINRYSSLDKLVKVTAWILRFIRNCRLSVSQRNMTPVVCPIERKKALLKLIEVVQATSFHSELKALRTKRPKLRGAIARLSPFVDGQGLIRVGGRLSNSNLPYSARHPLLLPKKSQLVDLLVMDRHIANSHSGCNALLASLQREFWILSGRRTVRSVLFRCLPCYRLKASTMQPQMGDLPPDRVKKMRPFSGVGTDFAGPFMIKASRLRNVRLIKAYLCVFVCLSTKAVHLEVVADLTIEAFIASLDRFVSRRGLPELIRSDNGTNFVGADRYLRDVVNFLNNNQVDIETALSRRGIRWTFSPPGCPHWGGIFEAVVKSAKTHLMRVIGQTSLTFEELTTVFCKIEAVLNSRPLCPLSSDPNDLESLTPGHFLIGQPLNALPEYPLSDIKPGRLRRYQMLQQMSQDFWKRWSLEYLHLLQQRFKWTDRTSPPHVGDLVLVKDANLPPLRWRRGRIVNLFPGKDGTPRSAEVLVGDSVLKRAVTTLSRLPVD

Summary

EMBL
LNIX01000007    OXA51795.1    LNIX01000016    OXA46198.1    ABLF02030698    ABLF02030705    + More
ABLF02030709    KK114194    KFM61875.1    ABLF02039606    ABLF02005684    LNIX01000069    OXA36894.1    ABLF02023842    ABLF02028949    ABLF02058391    GEZM01085145    GEZM01085143    JAV60187.1    GEBQ01022991    GEBQ01006185    JAT16986.1    JAT33792.1    LBMM01009888    KMQ87813.1    GEBQ01007199    GEBQ01000222    JAT32778.1    JAT39755.1    LNIX01000036    OXA39969.1    GEZM01054765    JAV73413.1    ABLF02021785    ABLF02054908    LBMM01010405    KMQ87487.1    ABLF02006304    ABLF02036268    ABLF02041614    ABLF02001506    ABLF02008029    ABLF02035899    ABLF02037719    ABLF02046327    ABLF02064627    ABLF02030854    ABLF02067347    GGMR01010723    MBY23342.1    LBMM01009964    KMQ87756.1    GGMR01002024    MBY14643.1    LBMM01008464    KMQ88855.1    LBMM01009645    KMQ87967.1    LBMM01009202    KMQ88311.1    GGMR01018294    MBY30913.1    ABLF02028666    ABLF02066713    ABLF02035780    GGMR01016460    MBY29079.1    ABLF02008636    ABLF02065931    LNIX01000002    OXA60848.1    GEBQ01015458    JAT24519.1    ABLF02025193    GEBQ01000825    JAT39152.1    GBHO01044317    GBHO01044315    JAF99286.1    JAF99288.1    GBHO01038805    GBHO01038804    GBHO01038801    JAG04799.1    JAG04800.1    JAG04803.1    LBMM01006490    KMQ90572.1    GGMR01002187    MBY14806.1    GBHO01034065    GBHO01034061    JAG09539.1    JAG09543.1    GEZM01060254    JAV71154.1    LBMM01009551    KMQ88039.1    ABLF02008594    GGMR01005823    MBY18442.1    LBMM01007859    KMQ89359.1    GBRD01007977    JAG57844.1    GGMR01013370    MBY25989.1    ABLF02015138    LBMM01009746    KMQ87900.1    LBMM01009898    KMQ87805.1    ABLF02041599    GGMS01014951    MBY84154.1    GGMR01006575    MBY19194.1    ABLF02004035    ABLF02004036    ABLF02004037    ABLF02004038    ABLF02008018    ABLF02008020    ABLF02012635    ABLF02061171    GGMS01010524    MBY79727.1    ABLF02022040    ABLF02056888    GGMR01017890    MBY30509.1    OXA59522.1    LBMM01009688    KMQ87939.1    GGMR01002421    MBY15040.1    LBMM01010417    KMQ87475.1    GGMS01012379    MBY81582.1    ABLF02036131    ABLF02041527    ABLF02064049    GFTR01008866    JAW07560.1    ABLF02067195    GGMR01020500    MBY33119.1    GEZM01066272    JAV68024.1    GGMR01018506    MBY31125.1    GBHO01007689    JAG35915.1    ABLF02041650    GGMR01014351    MBY26970.1    GBHO01008418    GBHO01008416    JAG35186.1    JAG35188.1    GGMR01005535    MBY18154.1    GBHO01044316    JAF99287.1    GBBI01004479    JAC14233.1    GFTR01008874    JAW07552.1    GEZM01021505    JAV88969.1    QOIP01000009    RLU19024.1    ABLF02041762    ABLF02041670    LNIX01000005    OXA54454.1    ABLF02006784    GGMR01014306    MBY26925.1    GDHC01014057    JAQ04572.1    GBBI01004211    JAC14501.1   
Pfam
PF17921   Integrase_H2C2        + More
PF05585   DUF1758
PF03564   DUF1759
PF00665   rve
PF05380   Peptidase_A17
PF18701   DUF5641
PF17919   RT_RNaseH_2
PF17917   RT_RNaseH
PF00078   RVT_1
PF09337   zf-H2C2
Interpro
IPR036397   RNaseH_sf        + More
IPR041588   Integrase_H2C2       
IPR005312   DUF1759       
IPR040676   DUF5641       
IPR008737   Peptidase_asp_put       
IPR008042   Retrotrans_Pao       
IPR012337   RNaseH-like_sf       
IPR001878   Znf_CCHC       
IPR001584   Integrase_cat-core       
IPR021109   Peptidase_aspartic_dom_sf       
IPR000477   RT_dom       
IPR041373   RT_RNaseH       
IPR001969   Aspartic_peptidase_AS       
IPR041577   RT_RNaseH_2       
IPR001995   Peptidase_A2_cat       
IPR015416   Znf_H2C2_histone_UAS-bd       
IPR036875   Znf_CCHC_sf       
IPR000727   T_SNARE_dom       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
1807
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01729
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00063
outside
1  -  1807
 
 

Population Genetic Test Statistics

Pi
151.02687
Theta
161.927666
Tajima's D
-1.070651
CLR
0.674813
CSRT
0.122193890305485
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号