SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06653
Pre Gene Modal
BGIBMGA011777
Annotation
acidic_lipase_[Helicoverpa_armigera]
Full name
Lipase      
Location in the cell
PlasmaMembrane   Reliability : 2.899
 

Sequence

CDS
ATGCGATTTCAAGGCATACTTTTAATTTGTATGTTCTGTTTTAGTTTCGGAGATGCTCGATCATCTCCGAACGTTGAAGTGGTGAGAACACTTTTTGGTAACGACAAAGGCGCCCGTTATTCTAATAATGTAATCGAAGATGCTGAATTGGATGTGCCCGACCTAATCAGGAAATATGGCTATCCCGTAGAAGTTCATCACGTGTCCACCCCAGATGGTTATATCCTGGAAATGCATCGTATCCCTCATGGACGATATGCGAACAACAGACCTAATAGTAAAAAACCTGTCGTTTTCCTGATGCACGGTCTGCTCTGTTCCTCAGCTGACTGGGTGATGACAGGCCCTAAACTTGGACTGGGTTATATTCTAGCTGAAGAGGGATATGATGTTTGGATGGGTAACGCTAGAGGCAATTATTATTCCCGAAGACACATTTCTTTAAACCCAGATAGCTTCATTAGTACTCAATTTTGGAAATTTTCTTGGGACGAGATAGGAAATATAGATTTGCCCGCTATGATAGATTTTTCACTGAGGAGAAGTGGACAAAAAAAATTGCATTATATTGGGCATTCTCAGGGATCAACTGCCTTCTTTGTGATGACATCATTACGTCCGGAGTATAACCAGAAAATCATATCAATGCAAGCGTTGGCACCTGTAGCGTACATGGGTCACAACAAAAATCCTTTATTGCTAGCTATAGCACCATTCGCCCATGAATTAGTGACTTTAGCATCATTAATAGGAATTGGGGAGTTCTTGCCGAACAGTAGGGTTTTCACTTGGGCAGGACAAACCTTTTGTAAGGATGAAGTTGTGTTTCAACCTATATGCAGCAACATTCTTTTCTTGATCGGTGGATGGAACGAACAACAGCTCAACACGACTTTACTGCCCGTGAAATTCGGTCACACTCCCGCTGGTGCTGCAGCAAGACAGTTGGCTCATTATGGTCAAGGAATTGCCGGAAAGGAATTCCGTCGTTACGACCACGGTAGTAGACTAGCAAACAGAAGAGCCTATGGAACTAGCACTCCGCCAAAGTACGACTTATCGAAAGTGACCGCACCCGTGTTCCTTCACTATTCCGACAATGATCCTCTCGCCGAAATCGAGGATGTTGAGATATTGTATAGAGAGCTCGGAAACCCAGTAGGAATGTTCCGGGTGCCCTTGGCGACATTCAACCATTTAGATTTCTTGTGGGCCATTGACGTTAGGACTTTGTTATACGACACTGTCATCTATTATATGAAAACAATGAACGAGGACGCTTAA
Protein
MRFQGILLICMFCFSFGDARSSPNVEVVRTLFGNDKGARYSNNVIEDAELDVPDLIRKYGYPVEVHHVSTPDGYILEMHRIPHGRYANNRPNSKKPVVFLMHGLLCSSADWVMTGPKLGLGYILAEEGYDVWMGNARGNYYSRRHISLNPDSFISTQFWKFSWDEIGNIDLPAMIDFSLRRSGQKKLHYIGHSQGSTAFFVMTSLRPEYNQKIISMQALAPVAYMGHNKNPLLLAIAPFAHELVTLASLIGIGEFLPNSRVFTWAGQTFCKDEVVFQPICSNILFLIGGWNEQQLNTTLLPVKFGHTPAGAAARQLAHYGQGIAGKEFRRYDHGSRLANRRAYGTSTPPKYDLSKVTAPVFLHYSDNDPLAEIEDVEILYRELGNPVGMFRVPLATFNHLDFLWAIDVRTLLYDTVIYYMKTMNEDA

Summary

Similarity
Belongs to the AB hydrolase superfamily. Lipase family.
Feature
chain  Lipase
EMBL
BABH01011980    NWSH01000114    PCG79406.1    PCG79409.1    JF999959    AFI64313.1    + More
ODYU01004000    SOQ43434.1    ODYU01008119    SOQ51451.1    PCG79408.1    KQ459590    KPI97394.1    RSAL01000448    RVE41683.1    KQ461190    KPJ07151.1    PCG79412.1    ODYU01012265    SOQ58477.1    KPJ07150.1    KPI97393.1    KPI97395.1    KPJ07152.1    PCG79407.1    KPJ07153.1    KPI97391.1    RSAL01000137    RVE46199.1    BABH01033349    BABH01033350    BABH01033351    BABH01033352    KPI97392.1    BABH01033355    GDQN01008173    JAT82881.1    AGBW02008724    OWR52685.1    AGBW02010324    OWR48717.1    LADJ01067081    KPJ21692.1    BABH01020326    NWSH01005801    PCG63937.1    GFDF01005647    JAV08437.1    GFDF01005646    JAV08438.1    AGBW02009374    OWR50972.1    GFDF01005644    JAV08440.1    GFDF01005645    JAV08439.1    KQ460855    KPJ11879.1    GFDF01005639    JAV08445.1    RSAL01000145    RVE45945.1    ODYU01012460    SOQ58781.1    KQ459601    KPI94007.1    RSAL01000004    RVE54656.1    GFDF01005642    JAV08442.1    GFDF01005643    JAV08441.1    ATLV01011799    KE524723    KFB36142.1    AXCN02000090    CH477866    EAT35491.1    NWSH01001918    PCG69686.1    GFDF01002510    JAV11574.1    JF999958    AFI64312.1    ODYU01012554    SOQ58947.1    KK852794    KDR16428.1    ADMH02002130    ETN58534.1    APCN01002227    LJIG01001091    KRT85849.1    AAAB01008820    EAL41497.4    GAMD01001453    JAB00138.1    GFDF01002509    JAV11575.1    ATLV01020990    KE525311    KFB45956.1    KQ971338    KYB28091.1    JF303742    ADZ54058.1    EFA01616.1    DS231848    EDS36642.1    GFDF01002505    JAV11579.1    CH478517    EAT32843.1    AJVK01016188    JXUM01107700    KQ565165    KXJ71265.1    EAT35487.1    APCN01000436    AAAB01008859    EAA08216.4    AXCM01003911    KK107599    QOIP01000012    EZA48594.1    RLU15932.1    EDS36638.1    EFA01613.1    LBMM01002941    KMQ94155.1    AJWK01028000    NEVH01009768    PNF32784.1    EAA05393.4    ADMH02001587    ETN61958.1   
Pfam
PF04083   Abhydro_lipase        + More
PF00561   Abhydrolase_1
PF12146   Hydrolase_4
Interpro
IPR029058   AB_hydrolase        + More
IPR025483   Lipase_euk       
IPR006693   AB_hydrolase_lipase       
IPR000073   AB_hydrolase_1       
IPR022742   Hydrolase_4       
SUPFAM
SSF53474   SSF53474       
Gene 3D
PDB
1K8Q     E-value=1.17409e-72,     Score=695

Ontologies

Topology

SignalP
Position:   1 - 19,         Likelihood:  0.997256
 
 
Length:
427
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.93806
Exp number, first 60 AAs:
0.06176
Total prob of N-in:
0.02340
outside
1  -  427
 
 

Population Genetic Test Statistics

Pi
248.091205
Theta
227.407307
Tajima's D
0.240775
CLR
0.400494
CSRT
0.441277936103195
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号