SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06647
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.802 Nuclear   Reliability : 1.262
 

Sequence

CDS
ATGTTGGCATCTATTTTCAATGCCGCTATGGCGAACTGTATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGCATACATAAACCCGGTAAACCAAAAAATCATCCGACGAGCTACCGCCCGATTAGCCTCCTCATGTCTCTAGGCAAACTGTATGAGCGTCTGCTCTACAAACGCCTCAGAGACTTCGTCTCATCCAAGGGCATTCTCATCGATGAACAATTCGGATTCCGTACAAATCACTCATGCGTTCAACAGGTGCACCGCCTCACGGAGCACATTCTTGTGGGGCTTAATCGACCAAAACCGTTATACACGGGAGCTCTCTTCTTCGACGTCGCAAAAGCGTTCGACAAAGTCTGGCACAATGGTTTGATTTTCAAACTATTCAACATGGGCGTGCCGGATAGTCTCGTGCTCATCATACGGGACTTCTTGTCGAACCGCTCTTTTCGATATCGAGTCGAGGGAACCCGCTCCTCCCCACGACCTCTCACAGCTGGAGTCCCGCAAGGCTCTGTCCTCTCACCCCTCCTATTTAGCTTATTCGTCAACGATATTCCCCGGTCGCCGCCGACCCATTTAGCTTTATTCGCCGACGACACGACTGTTTACTATTCTAGTAGAAATAAGTCCCTAATCGCGAAGAAGCTTCAGAGCGCAGCCCTAGCCCTAGGACAGTGGTTCCGAAAATGGCGCATAGACATCAACCCAGCGAAAAGTACTGCGGTGCTATTTCAGAGGGGAAGCTCCACACGGATTTCCTCCCGGATTAGGAGGAGGAATCTCACACCCCCGATTACTCTCTTTAGACAACCCATACCCTGGGCCAGGAAGGTCAAGTACCTGGGCGTTACCCTGGATGCATCGATGACATTCCGCCCGCATATAAAATCAGTCCGTGACCGTGCCGCGTTTATTCTCGGTAGACTCTACCCCATGATCTGTAAGCGGAGTAAAATGTCCCTTCGGAACAAGGTGACACTTTACAAAACTTGCATAAGGCCCGTCATGACTTACGCGAGTGTGGTGTTCGCTCACGCGGCCCGCACACACATAGACACCCTCCAATCCCTACAATCCCGCTTTTGCAGGTTAGCTGTCGGGGCTCCGTGGTTCGTGAGGAACGTTGACCTACACGACGACCTGGGCCTCGAATCAATTCGGAAATACATGAAGTCAGCGTCGGAACGATACTTCGATAAGGCTATGCGTCATGATAATCGCCTTATCGTTGCCGCCGCTGACTACTCCCCGAATCCTGATCATGCAGGAGCCAGTCACCGTCGACGCCCTAGACACGTCCTTACGGATCCATCAGATCCAATAACCTTTGCATTAGATGCCTTCAGCTCTAATACTAGGGGCAGGCTTAGGGACCCCGTTAACGCCCGTCGACGGACCGTCGAGGCGATCCGCCCGGTCCTCTCGGACTGGGTGAATCGCGACCGAGGACGTCTCACCTTCCGAGCGACGCAGGTGCTCACGGGACACGGCTGTTTCGGTCGCTACCTGCACCTCGTCGCCCGGAGGGAGCCGACGCCGAAGTGCCACCACTGCAGTGGCTGCAACGAGGACACGGCGGAGCACACGCTCGCGTACTGCCCCGCTTTCGCGGAGCAGCGCCGCGTCCTCGTTGCAAAAATAGGACCGGACTTGTCGCTTCCGACCGTCGTGGCTACGATACTCGGCAGCGACGAGTCCTGGCAGGCGATGCTCGACTTCTGCGAGTCCACCATCTCGCAGAAGGAGGCGGCGGAACGGGAGAGGGAGAGCTCTTCTTCCCTCTCGGCGCCGTGCCGCCGCCGTCGGGCCGGGGGCCGGAGGAGGGCGTTTGTCCAGCTCCAGCCCCTATGA
Protein
MLASIFNAAMANCIFPAVWKEADVIGIHKPGKPKNHPTSYRPISLLMSLGKLYERLLYKRLRDFVSSKGILIDEQFGFRTNHSCVQQVHRLTEHILVGLNRPKPLYTGALFFDVAKAFDKVWHNGLIFKLFNMGVPDSLVLIIRDFLSNRSFRYRVEGTRSSPRPLTAGVPQGSVLSPLLFSLFVNDIPRSPPTHLALFADDTTVYYSSRNKSLIAKKLQSAALALGQWFRKWRIDINPAKSTAVLFQRGSSTRISSRIRRRNLTPPITLFRQPIPWARKVKYLGVTLDASMTFRPHIKSVRDRAAFILGRLYPMICKRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARTHIDTLQSLQSRFCRLAVGAPWFVRNVDLHDDLGLESIRKYMKSASERYFDKAMRHDNRLIVAAADYSPNPDHAGASHRRRPRHVLTDPSDPITFALDAFSSNTRGRLRDPVNARRRTVEAIRPVLSDWVNRDRGRLTFRATQVLTGHGCFGRYLHLVARREPTPKCHHCSGCNEDTAEHTLAYCPAFAEQRRVLVAKIGPDLSLPTVVATILGSDESWQAMLDFCESTISQKEAAERERESSSSLSAPCRRRRAGGRRRAFVQLQPL

Summary

Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF03372   Exo_endo_phos
PF07530   PRE_C2HC
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
SUPFAM
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
619
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.28271
Exp number, first 60 AAs:
0.02884
Total prob of N-in:
0.01118
outside
1  -  619
 
 

Population Genetic Test Statistics

Pi
19.96156
Theta
18.614759
Tajima's D
-1.945731
CLR
172.163012
CSRT
0.0145492725363732
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号