SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06644  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA011702
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.82
 

Sequence

CDS
ATGGAAAAAGAACACCAGCCAGACTCGATGGCTACAATAACTATGAAGCCGGAATATCCGCCTTCTGAAGTATACAGCACATCAGAACCGCCACCGGCTTATCGGCACAGGGTGTCAACTTCGGTCCAGATCGCGAAGATTGCAGCACTAACAGTGGTCGCTTCCTCCTTCATCTTGGGAACCTTTATATTGGCTTCGAGTTGGGTAGCAGCTCGTTCATCATGCCATCAGCTAGAGCAGCTGGATGCAATGCTCGACAAAGAACTCGCTTTGGAAGGCAGAGCCTACGGAAATGATGCCCTGGTAGCGGATGAGCCTTTGCCACTAGCAAATGCCCACGCTTTGCATGGAGTACCGCCCATGCTGTCTTCAGTGTTACCTGAGACGAGCCAGCCGTCATCTTCACGACCCAGTCTCTTCAAAGACGACGCACTCAACCATGCCGAGTCCAAAATAAACGAAGACAAATTGCAGAAAATTGACGACGATAAGAATGACTCACCAAACTCGAGTGATGAGAGTCCTGAGTCCGACAGTTCTGCTGAAGAGGACGACGAACTTGAAGCGATTAGACCGATGTTCAAATTGCCTATTCAGTTTGACCTTGATGAGTTGGCGGGCGCTTTCTTAGCAAACAACCAAAAAGGCCGTATGAACTGCGTGGTGGAGCGTCGTAACGACGACCCCATGGAGAGACGTTTTCCCTTCAACATTCTAGGCGCGTTCGCTCCCCGCAGCGCTCATGCCGAACGCGTAGCCATCATCTGCCACGGAGGAGATGAGCCCAGGGCAATCAATTTCCCGGAGCCACAGTCCCAGGTATTTGCCTTCCCGTTGACCGGTCCAGTACGCCTCCCTCTGCGTCCTCAGCCAGAGACACCTTCCGGTCCTGAACCCAGGATGCCTTTTGGACCTGGTCCTGACGGTAGAATGCCACCTTTCGCACAAGCTCCTGAACAAAGAATGCCGCCCTTCGCACAAGCTCCTGAACAAAGAATGCCGCCCTTCGCTCCACTAGGACCGATGGCACCAGTTAGCCGCCAGGCGTCCTTCCCGCTGCCGAGATTCACGCTGCGAACAGACTTAATTCCCGGCAGCTTTACTATCCCTGGCTACGGTAGCAGTCATGGTAACGGTAAGGCAGGGGGTGCGAAGAATCCCCGGGCTATGGACAGCTACCACCAAATGACCCTGGCGACTCTCAACACCCGGACCCTGCGGCTTGACGAACATATTGAGGAACTGGAAGTGGAATTAGGAAGGATACGATGGCACGTACTAGGGTTGTGCGAAGTCCGAAGACAGGGGGAGGACGTCATAACTCTGGACTCAGGCCACCTATTCTACTTCCGGGAAGGAGACCAACCTGGACAAGGTGGAGTTGGCTTTCTCGTCAATAAAATCCTCACAGACAATATTGTAGAGGTATCCAGTGTGTCGACACGGGTAGCGTACCTCGTAATTAAGCTCACCGAAAGGTACTCCCTTAAGGTGGTGCAAGTATACGCACCGACTTCGTCATACTCGGATGACGATGTGGAGGTTGTGTACGACGATATTACCAGGGCTCTGCACGATACCACAAAAGCCCACTTCAATGTTGTCATGGGAGATTTTAACGCTAAAGTGGGAGTACAGACTTGCGACGAATCGGTGCTAGGATCCTTCGGTTATGGATGTAGGAACCACAGGGGGCAAATGCTAGTCAACTTCCTTCAGCGCGAGAGGCTCTTTCTAATGAACTCGTTCTTTAAAAAGAAGCCACAAAGGAAGTGGACTTGGCTAAGCCCCGACACTGTGACGAAAAACGAGATAGACTTTATTATGACGGACAAGAAGCATATATTCAGGGATGTCTCTGTGATCAGCAGGTTCAATACCGGTAGTGATCACCGACTTGTCAGAGGCACACTGAATATGGACTTCAAGTTAGAACGCACTCGTCTAATAAAGTCTACGCTTCGACCCAGCCTACATCACATGGCTGTAGATCCGGAGCAATTCCAGCTAGATCTCCACAACCGATTCGCTGCCTTGGAAACCACCACAGACGTAGACGAGGCCTTAGATGGCGTGGTGAGGACACTGAGACAGGAGGGACAGAGACTGTGTCCAAAGGGTCGTACAGGCAGAACATCAAAGTTATCATCTGAGACTCTCCGGCTAATGGAAGATAGGCGAGAAAATACACAGGCCACACAATCAGAGAAGGTGGCTCTTAATAAGAAAATCAGGACGCTGATACGACGCGATCTCCGCCGGTACAATACTCAGCGGATCAATGACGCAATCGAGCAAAACCGAGGAGCCAAGGTGTTCGTGCAGCGTCTTGGTAAAAGCCACCCTACAAAACTGACCAAAAGGGATGGCCAAATTCTCTCCTCCAAACCGGAGATTCTCAAGGAAATTGAGGACTTCTACGGAGGCCTCTATACTTCCAAAGCAACTAAGCCTGTCTCCGACCCAGCAGATGTCCGAGCCACACTGTCCCGCCACTACACCGACGAGCTGCCACAGATTAGTGTAGACGAGATCGGCATGGCTCTTGAAAATCTTAAAAACGGAAAGGCCCCGGGGGAGGATGGTGTTACTTCTGAGCTCTTGAAAGCAGGAGGTCTTCCTGTTATTAGGGAGCTCCAGAAGCTCTTCAACACTGTCCTCTTTACCGGTAAAACTCCAAAGGCGTGGAGCAGGAGCATAGTTGTCCTTTTCTTTAAGAAAGGAGATAAGACACTTTTAAAGAATTATCGCCCCATCTCGCTCCTGAGCCACGTCTACAAATTGTTTTCAAGAGTCATAACAAATCGTCTTGCTCAGAGACTTGACGACTTCCAGCCTCCGGAACAGGCAGGATTCCGAAGAGGATTTGGTACCGTGGACCACATTCACACAGTTCGGCAGATTATACAGAAGACTGAAGAGTATAATCTGCCACTATGTCTGGCGTTTGTGGACTACGAGAAAGCCTTTGACTCGATCGAGACCTGGGCTGTTCTGGAATCTTTGCAGCGGTGTCAAGCTGACTGGCGATACATCGATGCACTAAGATGCCTGTACGATGCCGCTACAATGACCGTCCAAGTACAGAAAGACCAGACGAGACCAATCCAGTTGCGCAGAGGTGTAAGACAGGGGGATATTATATCCCCGAAACTGTTTACAAACGCACTGGAGGATGTCTTCAAGACTCTGGACTGGAACGGACGCGGCATCAACATAAACGGCGAGTACATCTCACATCTTCGCTTTGCCGATGATATCGTCATCATGGCGGAATCGCTGCAGGACCTACAAGAAATGGTGCACAGCCTTAATACTGCATCCCAACGGGTTGGCCTCGGAATGAACTTGGATAAAACCAAGGTAATGTTTAACGGAAACGTCATTCCGAGACCAATCGATGTTGGCGGTACACCTCTCGGAGTTGTTCAAGAGTATGTCTACCTGGGACAGACCCTACAACTAGGTAGAAACAACTTTGAGAAGGAAGTGACCAGAAGGATTCAGTTGGGCTGGGCAGCGTTCGGGAAGCTTCGTCAGGTCTTTTCGTCGCCCATACCACAATGTCTGAAGACAAAGGTCTATAATCAGTGCGTCCTACCCGTGCTTACCTACGGAGCCGAAACGTGGACACTGACTGTGCGACTGGTCCACCAATTAAAAGTTACTCAGCGAGCTATGGAGCGAGCTATGCTCGGTTTGTCATTGCGAGACCGAATACGCAATGAGGTCATTCGGGCAAAAACCAAAGTGATCGATATAGCTCGCAGAGTTAGTAAGCTGAAGTGGCAGTGGGCTGGTCACATATGTCGCAGAACCGATAACCGTTGGGGTAGACGTGTTCTGGAGTGGAGACCGCGAACCGGCAAACGTAGTGTAGGACGCCCTCCTGCTAGATGGAGCGACGACCTGCGCAAGGCAGCTGGCAAAGAGAGCCACAACAAACAAAATGATAAGGTGTACGCACACAGTATTGAAGAAGCGAGCAACCGTATTCCGCGTGTCCAACGAGGTCATTTTCCATCCTCGCTCATGGTATGGTTGGGAGTTTCTTATTGGGGCTTAACAGAGGTACATTTTTGTAAGAAAGGTGTAAAAACGAATGCAGTTGTGTATCAAAATACAGTCCTGACGAACCTTGTGGAACCTGTTTCTCATACCATGTTCAATAACAGGCACTGGGTATTCCAACAAGATTGGGCGCCAGCTCATAGAGCGAAGAGCACACCAGACTGGCTGGCGGCGTGTGAAATCGACTTCATCCGGCACGAAGACTGGCCCTCTTCCAGTCCAGATTTGAATCCGTTAGATTACAAGATATGGCAACACTTGGAGGAAAAGGCGTGCTCAAAGCCTCATCCCAATTTGGAGTCACTCAAGACATCCTTGATTAAGGCAGCCGCCGATATTGACATGGACCTCGTTCGTGCTGCGATAGACGACTGGCCGCGCAGATTGAAGGCCTGTATTCAAAATCACGGAGGTCATTTTGAATAA
Protein
MEKEHQPDSMATITMKPEYPPSEVYSTSEPPPAYRHRVSTSVQIAKIAALTVVASSFILGTFILASSWVAARSSCHQLEQLDAMLDKELALEGRAYGNDALVADEPLPLANAHALHGVPPMLSSVLPETSQPSSSRPSLFKDDALNHAESKINEDKLQKIDDDKNDSPNSSDESPESDSSAEEDDELEAIRPMFKLPIQFDLDELAGAFLANNQKGRMNCVVERRNDDPMERRFPFNILGAFAPRSAHAERVAIICHGGDEPRAINFPEPQSQVFAFPLTGPVRLPLRPQPETPSGPEPRMPFGPGPDGRMPPFAQAPEQRMPPFAQAPEQRMPPFAPLGPMAPVSRQASFPLPRFTLRTDLIPGSFTIPGYGSSHGNGKAGGAKNPRAMDSYHQMTLATLNTRTLRLDEHIEELEVELGRIRWHVLGLCEVRRQGEDVITLDSGHLFYFREGDQPGQGGVGFLVNKILTDNIVEVSSVSTRVAYLVIKLTERYSLKVVQVYAPTSSYSDDDVEVVYDDITRALHDTTKAHFNVVMGDFNAKVGVQTCDESVLGSFGYGCRNHRGQMLVNFLQRERLFLMNSFFKKKPQRKWTWLSPDTVTKNEIDFIMTDKKHIFRDVSVISRFNTGSDHRLVRGTLNMDFKLERTRLIKSTLRPSLHHMAVDPEQFQLDLHNRFAALETTTDVDEALDGVVRTLRQEGQRLCPKGRTGRTSKLSSETLRLMEDRRENTQATQSEKVALNKKIRTLIRRDLRRYNTQRINDAIEQNRGAKVFVQRLGKSHPTKLTKRDGQILSSKPEILKEIEDFYGGLYTSKATKPVSDPADVRATLSRHYTDELPQISVDEIGMALENLKNGKAPGEDGVTSELLKAGGLPVIRELQKLFNTVLFTGKTPKAWSRSIVVLFFKKGDKTLLKNYRPISLLSHVYKLFSRVITNRLAQRLDDFQPPEQAGFRRGFGTVDHIHTVRQIIQKTEEYNLPLCLAFVDYEKAFDSIETWAVLESLQRCQADWRYIDALRCLYDAATMTVQVQKDQTRPIQLRRGVRQGDIISPKLFTNALEDVFKTLDWNGRGININGEYISHLRFADDIVIMAESLQDLQEMVHSLNTASQRVGLGMNLDKTKVMFNGNVIPRPIDVGGTPLGVVQEYVYLGQTLQLGRNNFEKEVTRRIQLGWAAFGKLRQVFSSPIPQCLKTKVYNQCVLPVLTYGAETWTLTVRLVHQLKVTQRAMERAMLGLSLRDRIRNEVIRAKTKVIDIARRVSKLKWQWAGHICRRTDNRWGRRVLEWRPRTGKRSVGRPPARWSDDLRKAAGKESHNKQNDKVYAHSIEEASNRIPRVQRGHFPSSLMVWLGVSYWGLTEVHFCKKGVKTNAVVYQNTVLTNLVEPVSHTMFNNRHWVFQQDWAPAHRAKSTPDWLAACEIDFIRHEDWPSSSPDLNPLDYKIWQHLEEKACSKPHPNLESLKTSLIKAAADIDMDLVRAAIDDWPRRLKACIQNHGGHFE

Summary

Pfam
PF03372   Exo_endo_phos        + More
PF00078   RVT_1
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
SUPFAM
SSF56219   SSF56219       
Gene 3D
PDB
5CR4     E-value=4.26962e-09,     Score=152

Ontologies

GO

Topology

Length:
1498
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
21.63481
Exp number, first 60 AAs:
13.33609
Total prob of N-in:
0.95101
POSSIBLE N-term signal
sequence
inside
1  -  46
TMhelix
47  -  69
outside
70  -  1498
 
 

Population Genetic Test Statistics

Pi
163.046223
Theta
157.789095
Tajima's D
-0.543671
CLR
157.298942
CSRT
0.231738413079346
Interpretation
Possibly Positive selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号