SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06594
Pre Gene Modal
BGIBMGA001718
Annotation
PREDICTED:_uncharacterized_protein_LOC101745617_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 4.472
 

Sequence

CDS
ATGACAGCTAGTCAAAACACAAAAAAACTTTTGTGGGTACATTTAACAGAAGAATTCAATTCAATTGAATCAAATGCAAAGCGAAGTGAGGCCCAGCTCAAGAAGTGCTGGGATAATTTAAAAACACGGAGGAAGCACTTTTTGACTAATGAAAAGCGTCAGAGAATGAAGACTGGTGGCGGACAGTATATTCCAAATGAGCCACAGCCTGGTAGCAGCAATGAGACCCTTATTTTTGCTGAGGTTCTACTGGATCAGACTGATGTGGAACTCAGGGGTGTCATTGACAGTGATACCATTTACAGTTCTGAAGATATTGCAATGGAGCTTGAATCATCAGTTCCAGCAGCAGCGCAACCACAACAGAATGATGAAGTTCTGAGTGTAAGCTGTGCAAGATCATCAGCTGAAGAATACCAAAGTGTGAACACTCATATGCATCTTATGGGGTCCCATCTTACAGTTTGTGGTGGAGCTTCATCACAAGGAAATGTTGCAGGCACCACGCCTATGCATTACAGTCTATCATGTCGTGACACCCCACAACGTTGTGATACTCCACCACGTCGTGACACTCCACCAAGTCGTGACACTCCACCCAGTCGTGACACTCCACCAAGTCGTGACACTCCACCAAGTCGTGACACTCCACCACGTCGAGACACTCCACCACGTCGTGACACTCCACCACGTCGTGACACTCCACCGCGTCGTTCTGGGTCCCGGCAGACTGACTGTGGTGCAGCCTCCTTAGGAGGAGGGAATGTGCGCACCAGGGTAATTCAGGAGGAATTTAATTTTAGAAAAGAATCTTATGAAAAGAAAGAGAGAAGAGAAGACGAACTCTTTCAATTCCAAAAAAAGGAAAGAGAGTGGATGATGAAGGCAGCCGAAGAAGTATATCTAAAAGCGAAGGCTGAGAGGGAAGCTGCAGAGGATATTAAAAAATATAATCAGGCTAAAAGAGATTGTAGTGAAAAATAA
Protein
MTASQNTKKLLWVHLTEEFNSIESNAKRSEAQLKKCWDNLKTRRKHFLTNEKRQRMKTGGGQYIPNEPQPGSSNETLIFAEVLLDQTDVELRGVIDSDTIYSSEDIAMELESSVPAAAQPQQNDEVLSVSCARSSAEEYQSVNTHMHLMGSHLTVCGGASSQGNVAGTTPMHYSLSCRDTPQRCDTPPRRDTPPSRDTPPSRDTPPSRDTPPSRDTPPRRDTPPRRDTPPRRDTPPRRSGSRQTDCGAASLGGGNVRTRVIQEEFNFRKESYEKKERREDELFQFQKKEREWMMKAAEEVYLKAKAEREAAEDIKKYNQAKRDCSEK

Summary

Uniprot
ProteinModelPortal

Ontologies

GO

Topology

Length:
327
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0039
Exp number, first 60 AAs:
0
Total prob of N-in:
0.09451
outside
1  -  327
 
 

Population Genetic Test Statistics

Pi
256.985369
Theta
161.711627
Tajima's D
1.689779
CLR
0.44528
CSRT
0.821808909554522
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号