SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06512
Annotation
reverse_transcriptase_[Bombyx_mori]
Full name
Probable RNA-directed DNA polymerase from transposon BS      
Alternative Name
Reverse transcriptase
Location in the cell
Mitochondrial   Reliability : 1.602 Nuclear   Reliability : 1.215
 

Sequence

CDS
ATGAAGCTCGGTCGCGCTCCCGATTCCGTTCCCGTCACGAGGACTGTGGTGGATTGGCACACGCTGGGCATCAGCCTGGCTGAATCTGATCCACCATCGCTCCCGTTTAACCCGGACTCTATCCCGTCTCCTCAGGATACCGCTGAAGCCATAGACATCTTAACGTCACACATCACCTCGACATTAGATAGGTCATCGAAACAAGTTGTAGCGGAGGACTTCCTTCACCGCTTCAAATTGTCCGACGATATTAGGGAACTCCTTAGAGCTAAGAACGCCTCGATACGCGCCTACGACAGGTATCCTACCGCGGAAAATCGTATTAGAATGCGTGCCCTACAACGCGACGTAAAGTCTCGCATCGCCGAAGTCCGAGATGCCAGATGGTCTGATTTCTTAGAAGGACTCGCGCCCTCCCAAAGGTCTTACTACCGCTTAGCTCGTACTCTCAAATCGGATACGATAGTAACTATGCCCCCCCTCGTAGGCCCCTCAGGCCGACTCGCGGCGTTCGATGATGACGAAAAAGCAGAGCTGCTGGCCGATACATTGCAAACCCAGTGCACGCCCAGCACTCAATCCGTGGACCCTGTTCATGTAGAATTAGTAGACAGTGAGGTAGAACGCAGAGCCTCCTTGCCACCCTCTGATGCGTTACCACCCGTCACCCCGATGGAAGTTAAAGACTTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCGACGGTATATCCAACCGCGTTATTAAACTTCTACCCGTCCAACTCATCGTGATGTTGGCATCTATTTTCAATGCCGCTATGGCGAACTGTATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGCATACATAAACCCGGTAAACCAAAAAATCATCCGACGAGCTACCGCCCGATTAGCCTCCTCATGTCTCTAGGCAAACTGTATGAGCGTCTGCTCTACAAACGCCTCAGAGACTTCGTCTCATCCAAGGGCATTCTTATCGATGAACAATTCGGATTCCGTACAAATCACTCATGCGTTCAACAGGTGCACCGCCTCACGGAGCACATTCTTGTGGGGCTTAATCGACCAAAACCGTTATACACGGGAGCTCTCTTCTTCGACGTCGCAAAAGCGTTCGACAAAGTCTGGCACAATGGTTTGATTTTCAAACTATTCAACATGGGCGTGCCGGATAGTCTCGTGCTCATCATACGGGACTTCTTGTCGAACCGCTCTTTTCGATATCGAGTCGAGGGAACCCGCTCCTTCCCACGACCTCTCACAGCTGGAGTCCCGCAAGGCTCTGTCCTCTCACCCCTCCTATTTAGCTTATTCGTCAACGATATTCCCCGGTCGCCGCCGACCCATTTAGCTTTATTCGCCGACGACACGACTGTTTACTATTCTAGTAGAAATAAGTCCCTAATCGCGAAGAAGCTTCAGAGCGCAGCCCTAGCCCTAGGACAGTGGTTCCGAAAATGGCGCATAGACATCAACCCAGCGAAAAGTACTGCGGTGCTATTTCAGAGGGGAAGCTCCACACGGATTTCCTCCCGGATTAGGAGGAGGAATCTCACACCCCCGATTACTCTCTTTAGACAACCCATACCCTGGGCCAGGAAGGTCAAGTACCTGGGCGTTACCCTGGATGCATCGATGACATTCCGCCCGCATATAAAATCAGTCCGTGACCGTGCCGCGTTTATTCTCGGTAGACTCTACCCCATGATCTGTAAGCGGAGTAAAATGTCCCTTCGGAACAAGGTGACACTTTACAAAACTTGCATAAGGCCCGTCATGACTTACGCGAGTGTGGTGTTCGCTCACGCGGCCCGCACTCCCTACAATCCCGCTTTTGCAGGTTAG
Protein
MKLGRAPDSVPVTRTVVDWHTLGISLAESDPPSLPFNPDSIPSPQDTAEAIDILTSHITSTLDRSSKQVVAEDFLHRFKLSDDIRELLRAKNASIRAYDRYPTAENRIRMRALQRDVKSRIAEVRDARWSDFLEGLAPSQRSYYRLARTLKSDTIVTMPPLVGPSGRLAAFDDDEKAELLADTLQTQCTPSTQSVDPVHVELVDSEVERRASLPPSDALPPVTPMEVKDLIKDLRPRKAPGSDGISNRVIKLLPVQLIVMLASIFNAAMANCIFPAVWKEADVIGIHKPGKPKNHPTSYRPISLLMSLGKLYERLLYKRLRDFVSSKGILIDEQFGFRTNHSCVQQVHRLTEHILVGLNRPKPLYTGALFFDVAKAFDKVWHNGLIFKLFNMGVPDSLVLIIRDFLSNRSFRYRVEGTRSFPRPLTAGVPQGSVLSPLLFSLFVNDIPRSPPTHLALFADDTTVYYSSRNKSLIAKKLQSAALALGQWFRKWRIDINPAKSTAVLFQRGSSTRISSRIRRRNLTPPITLFRQPIPWARKVKYLGVTLDASMTFRPHIKSVRDRAAFILGRLYPMICKRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARTPYNPAFAG

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  Probable RNA-directed DNA polymerase from transposon BS
EC Number
2.7.7.49
EMBL
U07847    AAA17752.1    AB018558    BAA76304.1    AB055391    BAB21761.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    GEZM01008457    JAV94772.1    KQ973342    KXZ75569.1    GALX01005299    JAB63167.1    KQ971729    KYB24751.1    GALX01005359    JAB63107.1    GGMR01019198    MBY31817.1    ABLF02029306    ABLF02029314    ABLF02060138    GGMS01017914    MBY87117.1    GGMS01002955    MBY72158.1    ABLF02042518    ABLF02057746    GGMS01006359    MBY75562.1    ABLF02008463    RPOV01000134    RPJ78669.1    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    ABLF02028535    ABLF02028545    GFTR01008038    JAW08388.1    GFXV01007093    MBW18898.1    GBBI01004395    JAC14317.1    ABLF02008153    ABLF02008462    ABLF02008464    S59870    AAB26437.2    KQ973412    EFA12510.2    ABLF02040174    ABLF02040183    ABLF02055266    GBYB01008290    JAG78057.1    GBBI01004571    JAC14141.1    ABLF02021177    ABLF02027367    ABLF02066338    ABLF02034467    ABLF02041767    GGMR01018716    MBY31335.1    ABLF02003961    ABLF02059872    NEVH01006736    PNF36716.1    GGFJ01001858    MBW50999.1    GGMS01008766    MBY77969.1    NEVH01020071    PNF21969.1    NEVH01023962    PNF17612.1    NEVH01010546    PNF32261.1    GGFJ01001857    MBW50998.1    NEVH01007443    PNF35684.1    NEVH01021586    NEVH01006600    NEVH01002584    PNF19589.1    PNF37419.1    PNF41868.1    NEVH01003017    PNF40781.1    NEVH01018383    PNF23463.1    GGMR01003407    MBY16026.1    GGMR01000676    MBY13295.1    GBBI01001646    JAC17066.1    ABLF02033757    GGMS01000737    MBY69940.1    ABLF02040650    ABLF02040651    ABLF02056776    NEVH01005938    PNF38077.1    NEVH01001355    PNF42855.1    NEVH01007838    PNF34986.1    NEVH01000280    PNF43672.1    NEVH01014858    PNF27387.1    NEVH01002716    PNF41415.1    NEVH01000269    PNF43694.1    ABLF02016634    NEVH01021205    PNF19912.1    NEVH01022639    PNF18527.1    ABLF02017815    NEVH01019964    PNF22161.1    KK119261    KFM75202.1    NEVH01023961    PNF17613.1    NEVH01006754    PNF36554.1    ABLF02023911    NEVH01017542    PNF24034.1    NEVH01011985    PNF31054.1    ABLF02050434    ABLF02064867    NEVH01019376    PNF22596.1    GFDF01007661    JAV06423.1    GEZM01053022    JAV74219.1    NEVH01009134    PNF33528.1    NEVH01027074    PNF13841.1    NEVH01019080    PNF22876.1    JXUM01241784    KQ635293    KXJ62492.1    GFTR01008151    JAW08275.1    NEVH01015305    NEVH01006671    PNF27154.1    PNF37357.1    NEVH01017559    PNF23833.1    GGMR01014053    MBY26672.1    GFTR01008256    JAW08170.1    AY060438    AAL25477.1    GGFJ01002256    MBW51397.1    NEVH01026154    PNF14491.1    GGMR01013409    MBY26028.1    ABLF02055645   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
PF10551   MULE
PF07727   RVT_2
PF03184   DDE_1
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
IPR013083   Znf_RING/FYVE/PHD       
IPR018289   MULE_transposase_dom       
IPR013103   RVT_2       
IPR004875   DDE_SF_endonuclease_dom       
IPR036875   Znf_CCHC_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
619
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
5.68556
Exp number, first 60 AAs:
0
Total prob of N-in:
0.04250
outside
1  -  619
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0.6062
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号