SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06503
Annotation
hypothetical_protein_[Piscirickettsia_salmonis]
Location in the cell
Mitochondrial   Reliability : 1.666
 

Sequence

CDS
ATGGAAGCCTCTACAGTGGCGGCGTGGGCGCCCATGCGTCCACACCCGGTCGAGGTCGAGGGCGAGGCGGGGTGGTTCCGGGACACGATGCGTCGCATCTGTGATGTGTCGATGCCCCGGATCGGCCCTCGACTTCCCAATCGCCAGGCGTACTGGTGGTCGCCTGAAATCGCGCAACTCCGCGTGGAGTGCGTTCGGGCGAGGCGCGAGTGCGCCAGGCATCGCCGCCGCCACCTGCCGCGGCGCAACGATCCGGTTGCGTTCGCGGCAGTGGAGGCTCGGCTGCACGGCGCATTTCGCGTCGCGCAGAGAGCGCTGCAGCTGGCCATCAGAAGAGCCAAGGACCGACACATGGAGGGTCTCTTGGAGACGCTGAATGAGGATCCGTGGGGGCGGCCCTATCATATGGTGCGCAATAAAATGCGCCCATGGGCCCCCCCGATCACGGAGCGTCTCCAGCCTCAGCAGCTGCGGGACATCGTCTCGGTGCTGTTCCCGCAGGAGCGGGAGGGATTTGTCGCTCCCGCTATGGACGCGCCGCCGGAATACGACGGTGAAGTCCCTGCTGAGGTGCCCCATATAACGGGGGCGGAGCTCCGTGTGGCCGTGCGCAAAATGTGCGCGAAGGACACTGCACCCGGCCCGGACGGCGTCCATGGCCGGGTTTGGGCCTTGGCTCTTGGTGCCCTAGGGGACCGACTCTTGAGGCTTTACAACTCTTGCCTCGAGTCGGGACGGTTTCCTTCATCGTGGAGGACGGGCAGACTCGTGCTGTTGAGAAAGGAGGGGCGCCCGGCGGATACTGCCGCCGGGTACCGTCCCATCGTGTTGCTGGATGAGGTGGGCAAGCTGCTGGAACGTATTCTGGCGGCCCGCATCATTCAGCATCTGGTCGGGGTGGGACCCGATCTGTCGGCGGAACAGTATGGCTTCCGAGAGGGCCGCTCAACGGTGGACGCGATCCTTCGCGTGCGGGCCCTCTCGGAGGAGGCCATCTCCAGGGGCGGGGTGGCTTCGGCGGTGTCACTCGATATCGCCAATGCATTTAACACCCTGCCCTGGTCCGTGATAGGGGCGGCGCTAGAAAGACACGGAGTGCCCCCCTACCTTCGCCGCTGGTGGGTTCCTACTTGGAAGACAGATCGGTCACATGTACCGGACACGGTGGGATCGTGCACCGATTCCCGGTCGTGCGCGGTGTTCCACAGGGACGACACGTTGGTCGTGGCCCGGGGAGGGAGTTTTGCTGAGTCTGCCCGTCTTGCCACCGCTGGGGTGGCGCATGTCATCGGCAAAATCAGGAGATTGGGCCTCGACGTGGCGCTCAGTAAATCCGAGGCCATGTGGTTTCACAGGCCCCGGAGAGAGCCACCTGTCGATGCCCATATCGTGGTTGGAGGCGTCCGGATTGGGGTCGGGGTGCAGCTGAAGTATCTCGGCCTCATTCTGGACAGTCGTTGGACCTTCCGTGCTCACTTTCAGAACCTGGTCCCTCGTTTGTTGGGGGCGGCCGGCGCGTTAAGCCGGCTTCTGCCCAACATCGGGGGGCCTGACCAGGTGACGCGCCGTCTCTATACAGGAGTGGTGCGATCAATGGCCCTATACGGGGCGCCCGTGTGGGGCCAGTCCCTGGCCGTGGGGATGGCGAGGCTGCTGCAAAAGCCGCAACGCACCATCGCGGTCAGGGTCATTCGTGGTTATCGCACCATCTCCTTCGAGGCGGCGTGTGTACTGGCTGGGACGCCGCCTTGGGTTCTGGAAGCGGAGGCGCTCGCCGCTGACTATCAGTGGCGGGCTGACCTTCGTGCCCGGGGCGTGGCGCGTCCCAGCCCCAGTGTGGTCAGAGCGCGGAGGGCCCAATCTCGGCGGTCCGTGCTGGAATCATGGTCCAGGCGGCTGGCCGATCCTTCGGCTGGTCGTAGGACCGTCGAGGCGATTCGCCCAGTCCTTGTGGATTGGGTGAATCGTGACAGAGGACGCCTCATTTTCCGGCTCACGCAGGTTCTCACTGGGCATGGTTGCTTCGGTGAGTTCCTGCACCGGATCAGAGCCGAGCCGACGGCAGAGTGCCACCATTGTGATTGCGACTTGGACACGGCAGAGCATACGCTCGTCGCCTGCCCCGCATGGGAGGGGTGGCGCCGTGTCCTCGTCGCAAAAATAGGAAACGACTTGTCGTTGCCGAGTGTTGTGGCATCGATGCTCGGTGACGACGAGTCGTGGAAGGCGATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGCGTTAGAGACGCGCAAGCCCGCCGCCGTCGAGCGGGGGCCAGGGAGGCGGATTTCGCCCAAGCCCTGGCCCTCTAA
Protein
MEASTVAAWAPMRPHPVEVEGEAGWFRDTMRRICDVSMPRIGPRLPNRQAYWWSPEIAQLRVECVRARRECARHRRRHLPRRNDPVAFAAVEARLHGAFRVAQRALQLAIRRAKDRHMEGLLETLNEDPWGRPYHMVRNKMRPWAPPITERLQPQQLRDIVSVLFPQEREGFVAPAMDAPPEYDGEVPAEVPHITGAELRVAVRKMCAKDTAPGPDGVHGRVWALALGALGDRLLRLYNSCLESGRFPSSWRTGRLVLLRKEGRPADTAAGYRPIVLLDEVGKLLERILAARIIQHLVGVGPDLSAEQYGFREGRSTVDAILRVRALSEEAISRGGVASAVSLDIANAFNTLPWSVIGAALERHGVPPYLRRWWVPTWKTDRSHVPDTVGSCTDSRSCAVFHRDDTLVVARGGSFAESARLATAGVAHVIGKIRRLGLDVALSKSEAMWFHRPRREPPVDAHIVVGGVRIGVGVQLKYLGLILDSRWTFRAHFQNLVPRLLGAAGALSRLLPNIGGPDQVTRRLYTGVVRSMALYGAPVWGQSLAVGMARLLQKPQRTIAVRVIRGYRTISFEAACVLAGTPPWVLEAEALAADYQWRADLRARGVARPSPSVVRARRAQSRRSVLESWSRRLADPSAGRRTVEAIRPVLVDWVNRDRGRLIFRLTQVLTGHGCFGEFLHRIRAEPTAECHHCDCDLDTAEHTLVACPAWEGWRRVLVAKIGNDLSLPSVVASMLGDDESWKAMLDFCECTISQKEAAGRVRDAQARRRRAGAREADFAQALAL

Summary

Similarity
Belongs to the AB hydrolase superfamily. Lipase family.
EMBL
AB090825    BAC57926.1    AB078931    BAC06456.1    AB078935    BAC06462.1    + More
AB078930    BAC06454.1    AB078929    BAC06452.1    LBMM01012027    KMQ86470.1    KZ149896    PZC78733.1    D85594    BAA19776.1    AB078936    BAC06464.1    LBMM01006954    KMQ90166.1    LBMM01006671    KMQ90407.1    LBMM01004272    KMQ92618.1    LBMM01007036    KMQ90099.1    LBMM01006657    KMQ90417.1    LBMM01002480    KMQ94776.1    LBMM01002052    KMQ95336.1    LBMM01005948    KMQ91066.1    LBMM01015565    KMQ84759.1    LBMM01007425    KMQ89740.1    LBMM01003988    KMQ92922.1    LBMM01008448    KMQ88867.1    LBMM01004634    KMQ92224.1    LBMM01012412    KMQ86235.1    LBMM01008278    KMQ89009.1    LBMM01015025    KMQ84953.1    LBMM01004505    KMQ92346.1    LBMM01008422    KMQ88894.1    LBMM01005733    KMQ91252.1    ABLF02015311    ABLF02015320    ABLF02034009    ABLF02043484    LBMM01015018    KMQ84954.1    LBMM01006063    KMQ90967.1    LBMM01014122    KMQ85315.1    RSAL01003504    RVE40273.1    LBMM01005474    KMQ91485.1    ABLF02011238    GGMR01000779    MBY13398.1    GGMR01015159    MBY27778.1    GGMR01014195    MBY26814.1    LBMM01013668    KMQ85535.1    ABLF02012448    ABLF02012450    ABLF02012455    ABLF02012460    LBMM01005465    KMQ91492.1    GGMR01011682    MBY24301.1    ABLF02041886    GFXV01002090    MBW13895.1    KMQ94772.1    GFXV01003903    MBW15708.1    ABLF02013358    ABLF02013361    ABLF02054869    LBMM01003245    KMQ93755.1    LBMM01004262    KMQ92649.1    LBMM01004261    KMQ92650.1    LBMM01005216    KMQ91703.1    LBMM01015285    KMQ84870.1    ABLF02034925    ABLF02010223    ABLF02011183    ABLF02041884    ABLF02014378    ABLF02004674    ABLF02004675    ABLF02004676    ABLF02011637    GGMR01006838    MBY19457.1    ABLF02018942    ABLF02041885    ABLF02018808    ABLF02041557    GALA01001777    JAA93075.1    LBMM01008445    KMQ88871.1    GGMR01015354    MBY27973.1    ABLF02023257    ABLF02023401    ABLF02029423    ABLF02060278    AJ278684    CAB99192.1    ABLF02004854    ABLF02041317    LBMM01006977    KMQ90149.1    QOIP01000014    RLU15074.1    GALA01000302    JAA94550.1    ABLF02007989    GGMR01019493    MBY32112.1    GEHC01000964    JAV46681.1    ABLF02005203    ABLF02041316    GGMR01012748    MBY25367.1    ABLF02004597    ABLF02041324   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF01553   Acyltransferase
PF03372   Exo_endo_phos
PF01421   Reprolysin
PF00098   zf-CCHC
PF00151   Lipase
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR002123   Plipid/glycerol_acylTrfase       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR024079   MetalloPept_cat_dom_sf       
IPR001590   Peptidase_M12B       
IPR029058   AB_hydrolase       
IPR013818   Lipase/vitellogenin       
IPR000734   TAG_lipase       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
SSF53474   SSF53474       
Gene 3D

Ontologies

Topology

Subcellular location
Secreted  
Length:
784
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.15468
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00062
outside
1  -  784
 
 

Population Genetic Test Statistics

Pi
179.271053
Theta
3.076014
Tajima's D
2.072474
CLR
0.402874
CSRT
0.913154342282886
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号