SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06495
Pre Gene Modal
BGIBMGA002456
Annotation
PREDICTED:_uncharacterized_protein_LOC105388498_[Plutella_xylostella]
Location in the cell
Nuclear   Reliability : 4.117
 

Sequence

CDS
ATGGACAAACTTGAACTTCAATCAACTTGTTTCGAGAATATCAAGACTTTGTGTACAAAATACCGCAAAGATTCTTCGTCTCGAAAAACTGAAGAGTACCTCAACATACGTTTGTCATCTTTGGAAGAACAGTGGAGAGACTTCGAGGCGAGAAATGCCTTATTACTACTGGAACTGGAAGACAAAACTATACATTATTTCTCTGAAGACGTTTACAACAAAACTAAAGAAATGTATCTAGCAACAAAAACAGACTTAAACAACAGACTTAAATACTTGAAACAGCAAAAACATAGTGTGAATTTTGATTTAAGTGACATTTCTATTGACTACACTCAAGACTGCGAGGACGGAAAATCTGAGAAAATACAACAACTTTTAAATAAACAAGAATGCAATTTTAATGCGATTTATCATGCATTGTCTAAAATTGACATCATTAGAACTAGTGAAAAGTGGGAGCTGGAAGATAATTTTAACATTTTAAAATCAAAGTGGGAGTCCATCGACAAACTGCACTGGGAAATTGACTTTCAGCTGAAGGGGTCTAACGATCACTATTACCGCATGTACTCAGATATAGAAGAAAAATATGATGAATTGAGAAAACAACTTCAATCTAAAATTTGGTCGAATGCACACTATCAGCAGTCGACACCGAGAATGGAATTACCTGATTTTTACGGAAACTACAGTAAGTGGATATCTTTTAAGGATCTGTTTCTCGAAACCATCCATAACAACCCAACAATTAACAAAGCGCAAAAAATGAAACACCTGAAAACCAAATTGAAGGGGGAAGCAGAAAGTCTGGTACAGCATTTATCAGTCTGTGCTGAAAACTACAACTCCTGCTGGGATATTTTAGTGCAACGGTATGATAATCGCCGCCTACAATTTTCATCGTTTTTCAACACGATGATGAGTCTCCCTGTTATACATCAACCCGACGCTAACAATCTCAAGAAAATGCATGACGTCATTAAGGAATGCATGAACGGCATAGCTAACATCGGGCTGGATACGGCAACGTGGGATCCAATGATCGTGCATTTAATGTTGCCGAAATTAGATTCAACAACTTTAAATGATTATATGAACGAAATCCGAGATCACAGAGAATTACAAAACTTGCAAGATTTTTTATATTTTTTGGAGTGCAAGTTTATGGCATATGAAACTGCAAAATCAACAAAATCTGTTAAAAATACCACTTCCGAAAAAACATCTCATTGGAAACCGGCTAACAACAAACAACCTGTAAAAAAATTTACATATGACTCTAAGAAAACTTATAACTATCACGCTACTTATGGAAAATGCCCGAATTGTAATGGAAATCATGTTTTAATGCAATGTGCTAAATTTATTAACATGGATACTGCACAGCGAAACCACACTGTTGCGAAATTGAAACTCTGCAAAAATTGTCTCTATAGCCACAATAACGAAGAATGTAAATCAGCGAAAACGTGTAAGGAGTGTAACATGAAACATCATACCATGTTGCACAACGTGAACTGGAAAATTCCAGCGAATGGTAAAAATAACTTTGGACAACAAGCCTCCTCTTCTCAGCAACAAGCTTCGAATCACTTATCATCGGATAAAACTGAAATTTTACTAACTACAACTCTACTGAAAATAAAGGCTTATGATGGCACTTATGTAAAACTTAGGGCCCTCTTGGATCAGGGCTCGCAAGTAAACTTAATAACAGAAAATGCCGCTCAGGTATTACGCCTGCCGAGGAAAAGGTTCGCTGCTACCATCTCGGGGGTTGGTTCAGTATCTGGTGATTGCAGGGGTCAACTAAACTTATCTTGTAAATCAATAAACTCTGAATACGACTTCGAAATACAAGCACTTATAATGAAAAAACTTACAAATAACTTACCGAATGCTACTTTCGAAAAATCGAACTGGCCTCATTTGGAAAACTTAAAGCTGGCTGATCCTGACTTCAACATCTCTCGCCCCATCGACTTACTACTGGGTGCCGATGTTTATTCAGATATTATACTCAATGGAGTTTTGAAAGGAAGCTGTCAATCCCCTGTGGCACAACAGACACATCTAGGATGGATCCTATGTGGGAAAATGAAAACGTTTAATTGCCACGTGACCTTGGTGAACTTTGATGAATTAACAAAGTACTGGGAGAGCGAAGAAATACAAAATTCTGAAGATATTTCCAAGGACGACCAGTGTGAACAATTTTATTCGGAAACAGTACAACGTGCTCCCGACGGAAAATATATTGTGAAGATGCCACTCCGCCCTGACCTTAAAGAAAAATTAGATTATAAGCACCCAGACAAAGAGCAAATAAACCTGTTCATCACACAATGTTTGCCCGATGTGGGAATCGAACCCACGACCCTTGGCACAACAGTCAGGGCCGCTAACTACTGCACCACCGAGTCCGTCAAAATATGTATATGCATTACTCTCACCTAA
Protein
MDKLELQSTCFENIKTLCTKYRKDSSSRKTEEYLNIRLSSLEEQWRDFEARNALLLLELEDKTIHYFSEDVYNKTKEMYLATKTDLNNRLKYLKQQKHSVNFDLSDISIDYTQDCEDGKSEKIQQLLNKQECNFNAIYHALSKIDIIRTSEKWELEDNFNILKSKWESIDKLHWEIDFQLKGSNDHYYRMYSDIEEKYDELRKQLQSKIWSNAHYQQSTPRMELPDFYGNYSKWISFKDLFLETIHNNPTINKAQKMKHLKTKLKGEAESLVQHLSVCAENYNSCWDILVQRYDNRRLQFSSFFNTMMSLPVIHQPDANNLKKMHDVIKECMNGIANIGLDTATWDPMIVHLMLPKLDSTTLNDYMNEIRDHRELQNLQDFLYFLECKFMAYETAKSTKSVKNTTSEKTSHWKPANNKQPVKKFTYDSKKTYNYHATYGKCPNCNGNHVLMQCAKFINMDTAQRNHTVAKLKLCKNCLYSHNNEECKSAKTCKECNMKHHTMLHNVNWKIPANGKNNFGQQASSSQQQASNHLSSDKTEILLTTTLLKIKAYDGTYVKLRALLDQGSQVNLITENAAQVLRLPRKRFAATISGVGSVSGDCRGQLNLSCKSINSEYDFEIQALIMKKLTNNLPNATFEKSNWPHLENLKLADPDFNISRPIDLLLGADVYSDIILNGVLKGSCQSPVAQQTHLGWILCGKMKTFNCHVTLVNFDELTKYWESEEIQNSEDISKDDQCEQFYSETVQRAPDGKYIVKMPLRPDLKEKLDYKHPDKEQINLFITQCLPDVGIEPTTLGTTVRAANYCTTESVKICICITLT

Summary

EMBL
KZ150641    PZC70422.1    KZ150005    PZC75227.1    JTDY01001118    KOB74820.1    + More
KZ149989    PZC75621.1    NWSH01000402    PCG76662.1    NWSH01000070    PCG79985.1    ODYU01005059    SOQ45565.1    KZ150008    PZC75149.1    ODYU01012875    SOQ59395.1    ODYU01006730    SOQ48837.1    JTDY01001277    KOB74321.1    LBMM01011051    KMQ87060.1    GEZM01060253    JAV71158.1    GEZM01060254    JAV71154.1    LBMM01017223    KMQ84153.1    LBMM01008464    KMQ88855.1    LBMM01009746    KMQ87900.1    LBMM01009898    KMQ87805.1    LBMM01011516    KMQ86784.1    ODYU01008829    SOQ52773.1    GAMC01020546    JAB86009.1    KQ460036    KPJ18393.1    LBMM01004572    KMQ92278.1    LBMM01010405    KMQ87487.1    QOIP01000012    RLU15613.1    LBMM01009284    KMQ88248.1    KQ981619    KYN39239.1    ABLF02028666    ABLF02066713    GFTR01008874    JAW07552.1    JTDY01001331    KOB74176.1    KQ977963    KYM98425.1    ABLF02022040    ABLF02056888    QOIP01000003    RLU24798.1    GGMR01014413    MBY27032.1    LNIX01000026    OXA42254.1    KQ981002    KYN10407.1    ABLF02016109    ABLF02016113    GGMR01020322    MBY32941.1    GGMS01000724    MBY69927.1    GGMS01001896    MBY71099.1    AJWK01022907    LNIX01000018    OXA45284.1    LNIX01000063    OXA37200.1    KQ458793    KPJ04955.1    LNIX01000001    OXA61293.1    LNIX01000044    OXA38660.1    LNIX01000007    OXA51382.1    KQ460545    KPJ14069.1    LNIX01000003    OXA58579.1    LNIX01000002    OXA60848.1    ABLF02023723   
Pfam
PF05585   DUF1758        + More
PF03564   DUF1759
PF17921   Integrase_H2C2
PF00230   MIP
PF12259   Baculo_F
PF05380   Peptidase_A17
PF00665   rve
PF18701   DUF5641
PF00078   RVT_1
PF13843   DDE_Tnp_1_7
PF02145   Rap_GAP
Interpro
IPR005312   DUF1759        + More
IPR008737   Peptidase_asp_put       
IPR029060   PIN-like_dom_sf       
IPR021109   Peptidase_aspartic_dom_sf       
IPR001995   Peptidase_A2_cat       
IPR001584   Integrase_cat-core       
IPR000425   MIP       
IPR008042   Retrotrans_Pao       
IPR012337   RNaseH-like_sf       
IPR040676   DUF5641       
IPR023271   Aquaporin-like       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR022048   Envelope_fusion-like       
IPR000477   RT_dom       
IPR029526   PGBD       
IPR001969   Aspartic_peptidase_AS       
IPR001878   Znf_CCHC       
IPR000331   Rap_GAP_dom       
IPR035974   Rap/Ran-GAP_sf       
SUPFAM
SSF88723   SSF88723        + More
SSF53098   SSF53098       
SSF81338   SSF81338       
SSF50630   SSF50630       
SSF111347   SSF111347       

Ontologies

Topology

Length:
819
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00304
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00017
outside
1  -  819
 
 

Population Genetic Test Statistics

Pi
206.157607
Theta
146.424444
Tajima's D
0
CLR
0.205564
CSRT
0.370681465926704
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号