Gene
KWMTBOMO06475
Pre Gene Modal
BGIBMGA011861
Annotation
PREDICTED:_condensin_complex_subunit_2_[Amyelois_transitella]
Full name
Condensin complex subunit 2
Alternative Name
Barren homolog protein 1
Chromosome-associated protein H
Non-SMC condensin I complex subunit H
XCAP-H homolog
Barren homolog
Chromosome assembly protein xCAP-H
Chromosome-associated protein H
Non-SMC condensin I complex subunit H
XCAP-H homolog
Barren homolog
Chromosome assembly protein xCAP-H
Location in the cell
Nuclear Reliability : 2.804
Sequence
CDS
ATGATGGAAAATCCTTTAACTTCAACGCCTGCCTTATCCAGGATTAGTATTGGCGGGAGCAGTAACACTTCAATTAGAAGACGTAGTTTGATACCTCAAAATAGAGTGGCCAATTCAAGAAATGAGGAGTGCAATGATGATGATGCTGAAAGGTCATCACTTGTGGCATCAGATCGCGTGGTTGCATCTACCCCACAGGCATCTCCACGTCGTGGAAGGGAGACTATGTCTTCATCACCACAGAAAGAACATTTCCAAGGTTGCCTTAAACTTTATGCAGAAAATAAAATAACAAAAGACAATGCATGGAATCTACAATTGATAGATTTTATGACTTCCATGCTTCGACGTCACGATGCTCGTATGGATAACTTGCAAACTGCTTCCACTGTGGTTGATGCTTCTGCTAGAATATACTCATTCAGAGTTGATGCCGTGCATTATGATGTACTTAAAATGGCTGGTGGTTTAATTAAAGCTGCTCAGTCAAAAAGAGGCAAAAAAGATGATGAAAATATACAAGACGAAGGTGCATTAGATGGAGATGTGAATGCTGCACCCATTAAGAAAAAAAAGAAACGATCTAAAGGAGCGATAGCAGCAAATCCAGAAGTTTTTAATGGTGATTTCGACATCAATGACTGTATAGATCCATTTTTTGAGAGGCTGGCCGCAACTACAGGAGATGTCACATCATCAAATAGAGCGTTCAATGCTACATTACCAATTCATGACAAAACTCTTGCGCTTATTCTGAGGACCGACACCAAGTTTTTAGAACCTGTCAAGGAGAACATCCCTGAAGAGTTGGACTTGTCACACCGCATCACCCTCGCCGTAAAGTTACTGCCGCCGTTTTTAGAAACGGATGCATTATGTGAGCCTTTCACGGGTTTCTCTATAAGCAATTGGGATCCGGATACCGAAGACAATGGGGAAAACAGAGTGACAAATTGGGTGGAAGAGAACAGATTGAATCTATCACAGCAAGCCTTGGCTTTTGATGTCAATGCTGAAGTGGAGCCGATACCTCAGGATGACTTACACAATGATTTGTATGACGATGAGCCGCTGGGAGGCGTGGAGAGCGGCGAGGAGGCGGACGCGGCCGTGGCGGCGTGCGTGGCGCGCGTGGCCCTCCCCGCGCCCCGCCTGGCCGACGCGCGCCCCTCCGCGCCGCACCACGCGCGCCTCGAGTACTCCTACTGCTCCCTGGCCGCCGCATGGGCGGGGCCCGCGCACTGGAGACTCAAAAACAACAGAGCATCAAAGCTTTCCGAGCGAACGCAATCGATGGGCGGGCGGCTGATGGCGGACGGCAACAAGAAGCCGGCGCGGACGAAGCGGCAGTTAGACTTCGAAGGCGCGGGACTCACGTTCGACTGCCGGTCCGCGCCCGTCGGGGACTACGAGCCCATCCAGCCGGCCAAGATCATGATCAGCAGGAAGACGCTCGCCACGGGACACACGTGGAACGAGACCAACTTTAAAACTCCTATTGATAGAGGTCTGGACGAATCGCACTTCTGCAAATTATTTTTACTGCGTAAAGTGACGATGTCGCGGAAACGTGACAACGAACACAGCAAGCCCGAGGAGCCCGTCACGGTCGAGGAGGTGCGCGACTACGATTACAATAATGAAAATGATGCCTCATATTGTCCCAACATACCGCCGGATGCTGACGAGTGGGGCAACGAGGACGCCACGGCCGCCGGCGACCTGCACGAACAAGTCAAAGCCGTAGAACTCGAAGACATCGGGGACATGCTCGAACCACCAACAAAAGTGGCCAAAATATTCATACCATACGCGATGCGGGCGAAAAAGGTCGACATGAAACAATTGAAAAACTGTACCTGGAAGATGCTCACTGAAAAAACTCCAGAAGGTTCCAAAGACGAGGTCACGGAAACGTCATTCTTTTCGATTTATTCCAGACTTCCGAGCAAACTGACGCCGAATATGAGAGAATCATTAAGTGTACCATTAGCTTTACTCTCAATTTTGCATTTAGCAAACGAAAAAGGATTGATTTTAGAGAAACAAGAAGACCTTAAGGACTTTGGCATAATAGGTTTGATAAAATAA
Protein
MMENPLTSTPALSRISIGGSSNTSIRRRSLIPQNRVANSRNEECNDDDAERSSLVASDRVVASTPQASPRRGRETMSSSPQKEHFQGCLKLYAENKITKDNAWNLQLIDFMTSMLRRHDARMDNLQTASTVVDASARIYSFRVDAVHYDVLKMAGGLIKAAQSKRGKKDDENIQDEGALDGDVNAAPIKKKKKRSKGAIAANPEVFNGDFDINDCIDPFFERLAATTGDVTSSNRAFNATLPIHDKTLALILRTDTKFLEPVKENIPEELDLSHRITLAVKLLPPFLETDALCEPFTGFSISNWDPDTEDNGENRVTNWVEENRLNLSQQALAFDVNAEVEPIPQDDLHNDLYDDEPLGGVESGEEADAAVAACVARVALPAPRLADARPSAPHHARLEYSYCSLAAAWAGPAHWRLKNNRASKLSERTQSMGGRLMADGNKKPARTKRQLDFEGAGLTFDCRSAPVGDYEPIQPAKIMISRKTLATGHTWNETNFKTPIDRGLDESHFCKLFLLRKVTMSRKRDNEHSKPEEPVTVEEVRDYDYNNENDASYCPNIPPDADEWGNEDATAAGDLHEQVKAVELEDIGDMLEPPTKVAKIFIPYAMRAKKVDMKQLKNCTWKMLTEKTPEGSKDEVTETSFFSIYSRLPSKLTPNMRESLSVPLALLSILHLANEKGLILEKQEDLKDFGIIGLIK
Summary
Description
Regulatory subunit of the condensin complex, a complex required for conversion of interphase chromatin into mitotic-like condense chromosomes.
Regulatory subunit of the condensin complex, a complex required for conversion of interphase chromatin into mitotic-like condense chromosomes. The condensin complex probably introduces positive supercoils into relaxed DNA in the presence of type I topoisomerases and converts nicked DNA into positive knotted forms in the presence of type II topoisomerases. Early in neurogenesis, may play an essential role to ensure accurate mitotic chromosome condensation in neuron stem cells, ultimately affecting neuron pool and cortex size.
Regulatory subunit of the condensin complex, a complex required for conversion of interphase chromatin into mitotic-like condense chromosomes. The condensin complex probably introduces positive supercoils into relaxed DNA in the presence of type I topoisomerases and converts nicked DNA into positive knotted forms in the presence of type II topoisomerase.
Regulatory subunit of the condensin complex, a complex required for conversion of interphase chromatin into mitotic-like condense chromosomes. The condensin complex probably introduces positive supercoils into relaxed DNA in the presence of type I topoisomerases and converts nicked DNA into positive knotted forms in the presence of type II topoisomerases. Early in neurogenesis, may play an essential role to ensure accurate mitotic chromosome condensation in neuron stem cells, ultimately affecting neuron pool and cortex size.
Regulatory subunit of the condensin complex, a complex required for conversion of interphase chromatin into mitotic-like condense chromosomes. The condensin complex probably introduces positive supercoils into relaxed DNA in the presence of type I topoisomerases and converts nicked DNA into positive knotted forms in the presence of type II topoisomerase.
Subunit
Component of the condensin complex, which contains the SMC2 and SMC4 heterodimer, and three non SMC subunits that probably regulate the complex: NCAPH/BRRN1, NCAPD2/CAPD2 and NCAPG.
Component of the condensin complex, which contains the XCAP-E/SMC2 and XCAP-C/SMC4 heterodimer, and three non SMC subunits that probably regulate the complex: XCAP-H/NCAPH, XCAP-D2/NCAPD2 and XCAP-G/NCAPG.
Component of the condensin complex, which contains the XCAP-E/SMC2 and XCAP-C/SMC4 heterodimer, and three non SMC subunits that probably regulate the complex: XCAP-H/NCAPH, XCAP-D2/NCAPD2 and XCAP-G/NCAPG.
Similarity
Belongs to the CND2 (condensin subunit 2) family.
Keywords
Acetylation
Cell cycle
Cell division
Chromosome
Complete proteome
Cytoplasm
DNA condensation
Isopeptide bond
Mitosis
Nucleus
Phosphoprotein
Reference proteome
Ubl conjugation
Direct protein sequencing
Feature
chain Condensin complex subunit 2
Uniprot
H9JQQ5
A0A2A4JN71
A0A2W1BWN1
A0A2H1WML8
A0A194PV74
A0A0N1IDD2
+ More
A0A212FP44 A0A2J7PBF0 Q178C0 A0A1S4FC48 A0A084VS99 A0A2P8Y6N0 A0A182QLJ6 U5EZU8 A0A151IC28 A0A336LLN1 A0A182JH34 B0WXP7 A0A182R8K6 A0A182UUQ6 A0A182P1B6 E2ALK2 A0A0J7L883 Q5TRU6 A0A182LPC0 A0A182UIE9 F4X4U1 A0A1J1IHI9 A0A182MED7 A0A182K6E6 A0A182FU04 G3TQM4 A0A158NWA2 A0A151HY16 E9J4P2 G1NZ28 K7IP91 A0A1L8GS01 Q6NUE8 A0A182HNF2 A0A182XC53 V9KIM3 A0A1U7TLD7 Q8C156 A0A2K6PPE6 F1Q3I3 A0A2K6LEH8 A0A2K5NJ96 D4A8M7 A0A2K5NJL5 A0A2K5NJ16 A0A232F3X7 A0A2Y9HUZ6 A0A3Q7S2W3 A0A1Y1LM91 A0A2K5IA28 H9GDF5 A0A2K5I9N4 A0A2K5VR84 H9Z717 A0A2K5VQZ9 Q4R332 A0A2K6LEK6 O13067 A0A1V4KSS0 A0A0D9RXQ7 G7PMQ8 L5LB26 A0A3P8W999 A0A182MY38 G1QGM1 W5K272 A0A2I4HY31 F1SU46 A0A2U3XHU5 G1SY38 F6PU47 A0A1W4VKA1 F7FK26 Q28DW7 Q66KA2 V4ASX3 H2P550 A0A2J8R596 A0A1D5RE86 A0A2U3VWV8 A0A2K6U0X2 A0A2U3ZF57 A0A2R9BZS9 A0A3Q0CMS4 A0A182WFA5 A0A2R9C9X7 A0A2K6C9G0 A0A151MMA8 A0A2I2UVW9
A0A212FP44 A0A2J7PBF0 Q178C0 A0A1S4FC48 A0A084VS99 A0A2P8Y6N0 A0A182QLJ6 U5EZU8 A0A151IC28 A0A336LLN1 A0A182JH34 B0WXP7 A0A182R8K6 A0A182UUQ6 A0A182P1B6 E2ALK2 A0A0J7L883 Q5TRU6 A0A182LPC0 A0A182UIE9 F4X4U1 A0A1J1IHI9 A0A182MED7 A0A182K6E6 A0A182FU04 G3TQM4 A0A158NWA2 A0A151HY16 E9J4P2 G1NZ28 K7IP91 A0A1L8GS01 Q6NUE8 A0A182HNF2 A0A182XC53 V9KIM3 A0A1U7TLD7 Q8C156 A0A2K6PPE6 F1Q3I3 A0A2K6LEH8 A0A2K5NJ96 D4A8M7 A0A2K5NJL5 A0A2K5NJ16 A0A232F3X7 A0A2Y9HUZ6 A0A3Q7S2W3 A0A1Y1LM91 A0A2K5IA28 H9GDF5 A0A2K5I9N4 A0A2K5VR84 H9Z717 A0A2K5VQZ9 Q4R332 A0A2K6LEK6 O13067 A0A1V4KSS0 A0A0D9RXQ7 G7PMQ8 L5LB26 A0A3P8W999 A0A182MY38 G1QGM1 W5K272 A0A2I4HY31 F1SU46 A0A2U3XHU5 G1SY38 F6PU47 A0A1W4VKA1 F7FK26 Q28DW7 Q66KA2 V4ASX3 H2P550 A0A2J8R596 A0A1D5RE86 A0A2U3VWV8 A0A2K6U0X2 A0A2U3ZF57 A0A2R9BZS9 A0A3Q0CMS4 A0A182WFA5 A0A2R9C9X7 A0A2K6C9G0 A0A151MMA8 A0A2I2UVW9
Pubmed
19121390
28756777
26354079
22118469
17510324
24438588
+ More
29403074 20798317 12364791 20966253 21719571 21347285 21282665 21993624 20075255 27762356 24402279 16141072 15489334 21183079 25362486 16341006 15057822 15632090 22673903 28648823 28004739 21881562 25319552 15944441 9160743 9774278 10428035 22002653 24487278 25329095 30723633 20431018 17431167 23254933 22722832 28071753 22293439 17975172
29403074 20798317 12364791 20966253 21719571 21347285 21282665 21993624 20075255 27762356 24402279 16141072 15489334 21183079 25362486 16341006 15057822 15632090 22673903 28648823 28004739 21881562 25319552 15944441 9160743 9774278 10428035 22002653 24487278 25329095 30723633 20431018 17431167 23254933 22722832 28071753 22293439 17975172
EMBL
BABH01012286
NWSH01000980
PCG73269.1
KZ149967
PZC76153.1
ODYU01009339
+ More
SOQ53694.1 KQ459590 KPI97222.1 KQ461161 KPJ08015.1 AGBW02003646 OWR55518.1 NEVH01027114 PNF13654.1 CH477367 EAT42499.1 ATLV01015900 KE525041 KFB40843.1 PYGN01000865 PSN39905.1 AXCN02001633 GANO01000109 JAB59762.1 KQ978069 KYM97351.1 UFQS01000056 UFQT01000056 SSW98758.1 SSX19144.1 DS232171 EDS36577.1 GL440609 EFN65704.1 LBMM01000327 KMR01212.1 KMR01216.1 AAAB01008956 EAL40154.3 GL888679 EGI58514.1 CVRI01000052 CRK99727.1 AXCM01002993 ADTU01027852 KQ976730 KYM76438.1 GL768112 EFZ12202.1 AAPE02045608 CM004471 OCT86627.1 BC068643 AAH68643.1 APCN01001921 JW865313 AFO97830.1 AK028919 AK042706 BC021499 BC025060 AAEX03010895 AABR07053670 CH473949 EDL80101.1 NNAY01001020 OXU25464.1 GEZM01051645 JAV74762.1 AAWZ02030918 AAWZ02030919 AQIA01016644 AQIA01016645 AQIA01016646 AQIA01016647 AQIA01016648 JU474929 AFH31733.1 AB179436 BAE02487.1 U90125 LSYS01002146 OPJ86907.1 AQIB01138625 CM001288 EHH55753.1 KB113832 ELK23220.1 ADFV01128028 ADFV01128029 ADFV01128030 AEMK02000020 DQIR01200155 HDB55632.1 AAGW02007418 AAMC01014037 AAMC01014038 AAMC01014039 JSUE03011503 JSUE03011504 JSUE03011505 CR848562 CAJ81260.1 BC080490 AAH80490.1 KB201362 ESO96826.1 ABGA01091508 ABGA01091509 ABGA01285652 ABGA01285653 ABGA01285654 ABGA01285655 NDHI03003755 PNJ03693.1 PNJ03697.1 AJFE02015193 AJFE02015194 AKHW03005679 KYO25678.1 AANG04003404
SOQ53694.1 KQ459590 KPI97222.1 KQ461161 KPJ08015.1 AGBW02003646 OWR55518.1 NEVH01027114 PNF13654.1 CH477367 EAT42499.1 ATLV01015900 KE525041 KFB40843.1 PYGN01000865 PSN39905.1 AXCN02001633 GANO01000109 JAB59762.1 KQ978069 KYM97351.1 UFQS01000056 UFQT01000056 SSW98758.1 SSX19144.1 DS232171 EDS36577.1 GL440609 EFN65704.1 LBMM01000327 KMR01212.1 KMR01216.1 AAAB01008956 EAL40154.3 GL888679 EGI58514.1 CVRI01000052 CRK99727.1 AXCM01002993 ADTU01027852 KQ976730 KYM76438.1 GL768112 EFZ12202.1 AAPE02045608 CM004471 OCT86627.1 BC068643 AAH68643.1 APCN01001921 JW865313 AFO97830.1 AK028919 AK042706 BC021499 BC025060 AAEX03010895 AABR07053670 CH473949 EDL80101.1 NNAY01001020 OXU25464.1 GEZM01051645 JAV74762.1 AAWZ02030918 AAWZ02030919 AQIA01016644 AQIA01016645 AQIA01016646 AQIA01016647 AQIA01016648 JU474929 AFH31733.1 AB179436 BAE02487.1 U90125 LSYS01002146 OPJ86907.1 AQIB01138625 CM001288 EHH55753.1 KB113832 ELK23220.1 ADFV01128028 ADFV01128029 ADFV01128030 AEMK02000020 DQIR01200155 HDB55632.1 AAGW02007418 AAMC01014037 AAMC01014038 AAMC01014039 JSUE03011503 JSUE03011504 JSUE03011505 CR848562 CAJ81260.1 BC080490 AAH80490.1 KB201362 ESO96826.1 ABGA01091508 ABGA01091509 ABGA01285652 ABGA01285653 ABGA01285654 ABGA01285655 NDHI03003755 PNJ03693.1 PNJ03697.1 AJFE02015193 AJFE02015194 AKHW03005679 KYO25678.1 AANG04003404
Proteomes
UP000005204
UP000218220
UP000053268
UP000053240
UP000007151
UP000235965
+ More
UP000008820 UP000030765 UP000245037 UP000075886 UP000078542 UP000075880 UP000002320 UP000075900 UP000075903 UP000075885 UP000000311 UP000036403 UP000007062 UP000075882 UP000075902 UP000007755 UP000183832 UP000075883 UP000075881 UP000069272 UP000007646 UP000005205 UP000078540 UP000001074 UP000002358 UP000186698 UP000075840 UP000076407 UP000189704 UP000000589 UP000233200 UP000002254 UP000233180 UP000233060 UP000002494 UP000215335 UP000248481 UP000286640 UP000233080 UP000001646 UP000233100 UP000190648 UP000029965 UP000009130 UP000265120 UP000075884 UP000001073 UP000018467 UP000008227 UP000245341 UP000001811 UP000008143 UP000192221 UP000006718 UP000030746 UP000001595 UP000245340 UP000233220 UP000240080 UP000189706 UP000075920 UP000233120 UP000050525 UP000011712
UP000008820 UP000030765 UP000245037 UP000075886 UP000078542 UP000075880 UP000002320 UP000075900 UP000075903 UP000075885 UP000000311 UP000036403 UP000007062 UP000075882 UP000075902 UP000007755 UP000183832 UP000075883 UP000075881 UP000069272 UP000007646 UP000005205 UP000078540 UP000001074 UP000002358 UP000186698 UP000075840 UP000076407 UP000189704 UP000000589 UP000233200 UP000002254 UP000233180 UP000233060 UP000002494 UP000215335 UP000248481 UP000286640 UP000233080 UP000001646 UP000233100 UP000190648 UP000029965 UP000009130 UP000265120 UP000075884 UP000001073 UP000018467 UP000008227 UP000245341 UP000001811 UP000008143 UP000192221 UP000006718 UP000030746 UP000001595 UP000245340 UP000233220 UP000240080 UP000189706 UP000075920 UP000233120 UP000050525 UP000011712
Pfam
PF05786 Cnd2
Interpro
IPR022816
Condensin_barren_su2
ProteinModelPortal
H9JQQ5
A0A2A4JN71
A0A2W1BWN1
A0A2H1WML8
A0A194PV74
A0A0N1IDD2
+ More
A0A212FP44 A0A2J7PBF0 Q178C0 A0A1S4FC48 A0A084VS99 A0A2P8Y6N0 A0A182QLJ6 U5EZU8 A0A151IC28 A0A336LLN1 A0A182JH34 B0WXP7 A0A182R8K6 A0A182UUQ6 A0A182P1B6 E2ALK2 A0A0J7L883 Q5TRU6 A0A182LPC0 A0A182UIE9 F4X4U1 A0A1J1IHI9 A0A182MED7 A0A182K6E6 A0A182FU04 G3TQM4 A0A158NWA2 A0A151HY16 E9J4P2 G1NZ28 K7IP91 A0A1L8GS01 Q6NUE8 A0A182HNF2 A0A182XC53 V9KIM3 A0A1U7TLD7 Q8C156 A0A2K6PPE6 F1Q3I3 A0A2K6LEH8 A0A2K5NJ96 D4A8M7 A0A2K5NJL5 A0A2K5NJ16 A0A232F3X7 A0A2Y9HUZ6 A0A3Q7S2W3 A0A1Y1LM91 A0A2K5IA28 H9GDF5 A0A2K5I9N4 A0A2K5VR84 H9Z717 A0A2K5VQZ9 Q4R332 A0A2K6LEK6 O13067 A0A1V4KSS0 A0A0D9RXQ7 G7PMQ8 L5LB26 A0A3P8W999 A0A182MY38 G1QGM1 W5K272 A0A2I4HY31 F1SU46 A0A2U3XHU5 G1SY38 F6PU47 A0A1W4VKA1 F7FK26 Q28DW7 Q66KA2 V4ASX3 H2P550 A0A2J8R596 A0A1D5RE86 A0A2U3VWV8 A0A2K6U0X2 A0A2U3ZF57 A0A2R9BZS9 A0A3Q0CMS4 A0A182WFA5 A0A2R9C9X7 A0A2K6C9G0 A0A151MMA8 A0A2I2UVW9
A0A212FP44 A0A2J7PBF0 Q178C0 A0A1S4FC48 A0A084VS99 A0A2P8Y6N0 A0A182QLJ6 U5EZU8 A0A151IC28 A0A336LLN1 A0A182JH34 B0WXP7 A0A182R8K6 A0A182UUQ6 A0A182P1B6 E2ALK2 A0A0J7L883 Q5TRU6 A0A182LPC0 A0A182UIE9 F4X4U1 A0A1J1IHI9 A0A182MED7 A0A182K6E6 A0A182FU04 G3TQM4 A0A158NWA2 A0A151HY16 E9J4P2 G1NZ28 K7IP91 A0A1L8GS01 Q6NUE8 A0A182HNF2 A0A182XC53 V9KIM3 A0A1U7TLD7 Q8C156 A0A2K6PPE6 F1Q3I3 A0A2K6LEH8 A0A2K5NJ96 D4A8M7 A0A2K5NJL5 A0A2K5NJ16 A0A232F3X7 A0A2Y9HUZ6 A0A3Q7S2W3 A0A1Y1LM91 A0A2K5IA28 H9GDF5 A0A2K5I9N4 A0A2K5VR84 H9Z717 A0A2K5VQZ9 Q4R332 A0A2K6LEK6 O13067 A0A1V4KSS0 A0A0D9RXQ7 G7PMQ8 L5LB26 A0A3P8W999 A0A182MY38 G1QGM1 W5K272 A0A2I4HY31 F1SU46 A0A2U3XHU5 G1SY38 F6PU47 A0A1W4VKA1 F7FK26 Q28DW7 Q66KA2 V4ASX3 H2P550 A0A2J8R596 A0A1D5RE86 A0A2U3VWV8 A0A2K6U0X2 A0A2U3ZF57 A0A2R9BZS9 A0A3Q0CMS4 A0A182WFA5 A0A2R9C9X7 A0A2K6C9G0 A0A151MMA8 A0A2I2UVW9
Ontologies
GO
PANTHER
Topology
Subcellular location
Nucleus
In interphase cells, the majority of the condensin complex is found in the cytoplasm, while a minority of the complex is associated with chromatin. A subpopulation of the complex however remains associated with chromosome foci in interphase cells. During mitosis, most of the condensin complex is associated with the chromatin. At the onset of prophase, the regulatory subunits of the complex are phosphorylated by CDK1, leading to condensin's association with chromosome arms and to chromosome condensation. Dissociation from chromosomes is observed in late telophase (By similarity). With evidence from 2 publications.
Cytoplasm In interphase cells, the majority of the condensin complex is found in the cytoplasm, while a minority of the complex is associated with chromatin. A subpopulation of the complex however remains associated with chromosome foci in interphase cells. During mitosis, most of the condensin complex is associated with the chromatin. At the onset of prophase, the regulatory subunits of the complex are phosphorylated by CDK1, leading to condensin's association with chromosome arms and to chromosome condensation. Dissociation from chromosomes is observed in late telophase (By similarity). With evidence from 2 publications.
Chromosome In interphase cells, the majority of the condensin complex is found in the cytoplasm, while a minority of the complex is associated with chromatin. A subpopulation of the complex however remains associated with chromosome foci in interphase cells. During mitosis, most of the condensin complex is associated with the chromatin. At the onset of prophase, the regulatory subunits of the complex are phosphorylated by CDK1, leading to condensin's association with chromosome arms and to chromosome condensation. Dissociation from chromosomes is observed in late telophase (By similarity). With evidence from 2 publications.
Cytoplasm In interphase cells, the majority of the condensin complex is found in the cytoplasm, while a minority of the complex is associated with chromatin. A subpopulation of the complex however remains associated with chromosome foci in interphase cells. During mitosis, most of the condensin complex is associated with the chromatin. At the onset of prophase, the regulatory subunits of the complex are phosphorylated by CDK1, leading to condensin's association with chromosome arms and to chromosome condensation. Dissociation from chromosomes is observed in late telophase (By similarity). With evidence from 2 publications.
Chromosome In interphase cells, the majority of the condensin complex is found in the cytoplasm, while a minority of the complex is associated with chromatin. A subpopulation of the complex however remains associated with chromosome foci in interphase cells. During mitosis, most of the condensin complex is associated with the chromatin. At the onset of prophase, the regulatory subunits of the complex are phosphorylated by CDK1, leading to condensin's association with chromosome arms and to chromosome condensation. Dissociation from chromosomes is observed in late telophase (By similarity). With evidence from 2 publications.
Length:
696
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00603
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00010
outside
1 - 696
Population Genetic Test Statistics
Pi
330.633886
Theta
196.303193
Tajima's D
2.066545
CLR
0.258884
CSRT
0.894255287235638
Interpretation
Uncertain
