SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06465
Annotation
reverse_transcriptase_[Danaus_plexippus]
Location in the cell
Mitochondrial   Reliability : 1.122 Peroxisomal   Reliability : 1.107
 

Sequence

CDS
ATGCGTCGCATCTGTGATGCGTCGATGCCCCGGATCGGCCCTCGACTTCCTAATCGCCAGGCGTACTGGTGGTCGCCCGAAATTGCGCAACTCCGCGTGGAGTGCGTTCGGGAGAGGCGCGAGTGCGCCAGGCATCGCCGCCGCCGCCTGCCGCGACGCAATGATCCGGTTGCATTCGCGGCGGAAGAGGTCCGGCTGCACGGCGCATTTCGCGTCGCGCAGAGGGCATTGCAGCTGGCCATCAGAAGAGCCAAGAACCAACACATGGAGAGTCTCTTGGAGACGCTGGATGAGGATCCGTGGGGGCGGCCCTATCATATGGTGCGCAATAAAATGCGCCCATGGGCCCCCCCGATCACGGAGCGTCTCCAGCCTCAGCAGCTGCGGGACATCGTCTCGGCGCTGTTCCCGCAGGAGCGGGAGGGATTTATCGCTCCCGCTATGGACGCGCCGCCGGAATACGACGGTGAAGTCCCTGCTGAGGTGCCCCATATAACGGGGGCGGAGCTCCGTGTGGCCGTGCGCAAAATGTGTGCGAAGGACACTGCACCCGGCCCGGACGGCGTCCATGGCCGGGTTTGGGCCTTGGCTCTTGGTGCCCTAGGGGACCGACTCTTAAGGCTTTACAACTCCTGCCTCGAGTCGGGACGGTTTCCTTCATCGTGGAGGACGGGCAGACTCGTGCTGTTGAGAAAGGAAGGACGCCCGGCGGATACTGCCGCCGGGTACCGTCCCATCGTGTTGCTGGATGAGGTGGGCAAGCTGCTGGAACGCATTCTGGCGGCCCGCATCATCCAGCATCTAGTCAGGGTGGGACCCAATCTGTCGGCGGAGCAGTATGGCTTCCGAGAGGGCCGCTCAACGGTAGACGCGATCCTTCGCGTGCGGGCCCTCTCGGAGGAGGCCGTCTCCAGGGGTGGGGTGGCTTTGGCGGTGTCGCTCGACATCGCCAATGCGTTTAACACCCTGCCCTGGTCCGTGATAAGGGGGGCGCTGGAACGACATGGAGTGCCTCCCTACCTTCGCCGGCTGGTGGGTTCCTACTTGGAGGACAGATCGGTCACATGTACCGGACACGGTGGGATCCTGCACCGGTTCCCGGTCGTGCGCGGTGTTCCACAGGGGTCGGTGCTCGGCCCCCTTTTGTGGAATATCGGGTATGACTGGGTGCTGAGAGGTGCCCTCCTCCCGGGCCTGAGCGTAATCTGTTACGCAGACGACACGTTGGTCGTGGCCCGGGGGGGTAGTTTTGCCGAGTCTGCCCGTCTTGCTACCGCTGGGGTGGCGCATGTCGTCGGCAAAATCAGGAGATTGGGCCTCGACGTGGCGCTCAGTAAATCCGAGGCCATGTGGTTCCACAGGCCCCGGAGAGTGCCACCTGTCGATGCCCATATCGTGAGCCTGGTCCCTCGTTTGTTGGGGGTGGCCGGCGCGTTAAGCCGGCTTCTGCCCAACGTCGGGGGGCCTGACCAGGTGACGCGCCGTCTCTATACGGGGGTGGTGCGATCAATGGCCCTATACGGGGCACCTGTGTGGGGCCAGTCCCTGGCCGCGGGGGTGGCGAAGCTGCTGCAACGGCCGCAACGCACCATCGCGGTCAGGGTCATCCGTGGTTATCGCACCATCTCCTTTGAGGCGGCGTGTGTACTGGCTGGGACGCCGCCTTGGGTTCTGGAAGCGGAGGCGCTCGCCGCTGACTATCAGTGGCGGGCTGACCTTCGTGCCCGGGACGTGGCGCGTCCCAGCCCCAGTGTGGTCAGAGCGCGGAGGGCCCAATCTCGGCGGTCCGTGCTGGAGTCATGGTCCAGACGGCTGGCTGATCCTTCGGCTGGTCGTAGGACCGTCGAGGCGATTCGCCCGGTCCTTGTGGATTGGGTGAATCGTGACAGAGGACGCCTCACTTTCCGGCTCACGCAGGTGCTCACTGGGCATGGTTGCTTCGGTGAGTTCCTGCACCGGATCACAGCCGAGCCGACGGCAGAGTGCCACCATTGTGGTTGCGACTTGGACACGGCAGAGCATACGCTCGTCGCCTGCCCCGCATGGGAGGGGTGGCGCCGTGTCCTCGTCGCAAAAATAGGAAACGACTTGTCGTTGCCGAGTGTTGTGGCATCGATGCTCGGCGACGACGAGTCATGGAAGGCGATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGCGTGAGAGACGCGCAAGCCCGCCGCCGTCGGGCGGGGGCCAGGGAGGCGGATCTCGCCCAAGCCCTGGCCCTCTAA
Protein
MRRICDASMPRIGPRLPNRQAYWWSPEIAQLRVECVRERRECARHRRRRLPRRNDPVAFAAEEVRLHGAFRVAQRALQLAIRRAKNQHMESLLETLDEDPWGRPYHMVRNKMRPWAPPITERLQPQQLRDIVSALFPQEREGFIAPAMDAPPEYDGEVPAEVPHITGAELRVAVRKMCAKDTAPGPDGVHGRVWALALGALGDRLLRLYNSCLESGRFPSSWRTGRLVLLRKEGRPADTAAGYRPIVLLDEVGKLLERILAARIIQHLVRVGPNLSAEQYGFREGRSTVDAILRVRALSEEAVSRGGVALAVSLDIANAFNTLPWSVIRGALERHGVPPYLRRLVGSYLEDRSVTCTGHGGILHRFPVVRGVPQGSVLGPLLWNIGYDWVLRGALLPGLSVICYADDTLVVARGGSFAESARLATAGVAHVVGKIRRLGLDVALSKSEAMWFHRPRRVPPVDAHIVSLVPRLLGVAGALSRLLPNVGGPDQVTRRLYTGVVRSMALYGAPVWGQSLAAGVAKLLQRPQRTIAVRVIRGYRTISFEAACVLAGTPPWVLEAEALAADYQWRADLRARDVARPSPSVVRARRAQSRRSVLESWSRRLADPSAGRRTVEAIRPVLVDWVNRDRGRLTFRLTQVLTGHGCFGEFLHRITAEPTAECHHCGCDLDTAEHTLVACPAWEGWRRVLVAKIGNDLSLPSVVASMLGDDESWKAMLDFCECTISQKEAAGRVRDAQARRRRAGAREADLAQALAL

Summary

EMBL
AB090825    BAC57926.1    AB078935    BAC06462.1    AB078931    BAC06456.1    + More
AB078929    BAC06452.1    AB078930    BAC06454.1    KZ149896    PZC78733.1    LBMM01012027    KMQ86470.1    D85594    BAA19776.1    KQ460685    KPJ12887.1    AB078936    BAC06464.1    LBMM01006671    KMQ90407.1    LBMM01006954    KMQ90166.1    LBMM01004272    KMQ92618.1    LBMM01007036    KMQ90099.1    LBMM01006657    KMQ90417.1    LBMM01005948    KMQ91066.1    RSAL01003504    RVE40273.1    LBMM01002480    KMQ94776.1    LBMM01005733    KMQ91252.1    LBMM01002052    KMQ95336.1    LBMM01008448    KMQ88867.1    LBMM01007425    KMQ89740.1    LBMM01004505    KMQ92346.1    LBMM01015565    KMQ84759.1    LBMM01012412    KMQ86235.1    LBMM01015025    KMQ84953.1    LBMM01003988    KMQ92922.1    LBMM01008278    KMQ89009.1    LBMM01004634    KMQ92224.1    LBMM01015018    KMQ84954.1    GGMR01000779    MBY13398.1    LBMM01008422    KMQ88894.1    LBMM01006063    KMQ90967.1    ABLF02015311    ABLF02015320    ABLF02034009    ABLF02043484    LBMM01014122    KMQ85315.1    ABLF02011238    LBMM01005474    KMQ91485.1    GGMR01014195    MBY26814.1    GGMR01015159    MBY27778.1    LBMM01008682    KMQ88705.1    ABLF02014378    LBMM01004262    KMQ92649.1    LBMM01006977    KMQ90149.1    LBMM01004261    KMQ92650.1    LBMM01003245    KMQ93755.1    ABLF02041886    LBMM01005216    KMQ91703.1    GFXV01002090    MBW13895.1    GGMR01004600    MBY17219.1    LBMM01015285    KMQ84870.1    GGMR01011682    MBY24301.1    LBMM01005465    KMQ91492.1    ABLF02041557    GGMR01006838    MBY19457.1    KMQ94772.1    ABLF02004674    ABLF02004675    ABLF02004676    ABLF02011637    ABLF02013358    ABLF02013361    ABLF02054869    ABLF02034925    LBMM01013668    KMQ85535.1    ABLF02011183    ABLF02041884    ABLF02018808    ABLF02018942    ABLF02041885    LBMM01008445    KMQ88871.1    GAPW01000192    JAC13406.1    GEHC01000915    JAV46730.1    GGMR01015354    MBY27973.1    GAMC01020517    JAB86038.1    GAMC01020519    GAMC01020515    JAB86040.1    ABLF02059310    ABLF02010223    GAKP01002292    JAC56660.1    KQ971309    EEZ99146.1    GALA01001777    JAA93075.1    GGMR01012748    MBY25367.1    ABLF02016340    AB593325    BAK38646.1    ABLF02004854    ABLF02041317    ABLF02007989    ABLF02023257    GEHC01000964    JAV46681.1    KQ972226    KYB24577.1    GALA01001776    JAA93076.1    AB593321    BAK38639.1    ABLF02021100    GALA01000302    JAA94550.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF01553   Acyltransferase
PF03372   Exo_endo_phos
PF01421   Reprolysin
PF00098   zf-CCHC
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR002123   Plipid/glycerol_acylTrfase       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR024079   MetalloPept_cat_dom_sf       
IPR001590   Peptidase_M12B       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D
PDB
6AR3     E-value=8.24193e-05,     Score=112

Ontologies

Topology

Length:
756
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0729899999999999
Exp number, first 60 AAs:
9e-05
Total prob of N-in:
0.00106
outside
1  -  756
 
 

Population Genetic Test Statistics

Pi
125.909189
Theta
21.670857
Tajima's D
3.027198
CLR
0
CSRT
0.980850957452127
Interpretation
Possibly Balancing Selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号