SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06459
Annotation
PREDICTED:_LOW_QUALITY_PROTEIN:_uncharacterized_protein_LOC105841899?_partial_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.543 Nuclear   Reliability : 1.017
 

Sequence

CDS
ATGGCACTATACGGCGCGCCCGTATGGTGCCACGCCCTGACCCGCCAGAACGTTGCCGCGCTGCGACGTCCGCAGCGCGCGATCGCGGTCAGGGCGATTCGAGGATACCGCACCGTCTCCTTCGAGGCGGCGTGCTTGCTCGCCGGGGCGCCACCCTGGGACCTGGAGGCGGAGGCGCTCGCTGCCGATTACAGGTGGCGTAGCGACCTCCGCTCTAGGGGGGAAGGGCGCCCCGGCGAAGGAGTAGTTCGAGCGCGGAGGCTCCAATCTCGGCGGTCCGTGCTGGAGGCGTGGTCTCGCCGCTTGGCGGACCCGTCGGCCGGCCTCCGTACCGTCGAGGCGGTCCGTCCGGTCCTCGCGGACTGGGTGGGCCGCGACCGCGGATGCCTCACCTTCCGGCTAACGCAGATGCTTACCGGCCATGGTTGTTTCGGCCGGTACTTGCACAAGATAGCCGGAAGGGAACCGACGGCGCAGTGCCACCACTGCGCGGACCGCGACGAGGAAGACACAGCGGAACACACATTGGCGCGTTGCTCTAGATTTGACGAGCAACGCGCCGCCCTCGTCGCGGTCATAGGAGAGGACCTCTCGCTGCCGCGCGTCGTGGCTACGATGCTCGGCAGCGACGCGTCCTGGAAGGCGATGCTCGACTTCTGCGAGTCCACCATATCGCAGAAGGAGGCGGCGGAGCGAGAGAGGGAGAGCTCTTCCCTTTCCGCACCGATCCGTCGCCGTCGAGCCGGGGGCCGGAGGCGGGAATACGCCCGTACGTCCCGGCCCCTGTGGGCCTTGAAACGGATGAACAAGGAGTTGCTGATGGAGGCGGCCGCTGTTGCTGCGTGGGCGCCAAAACCCGCGCGGCTCGCGGACGTGGATGCGGAGGTCGACTGGTTCCGGGGCACCATGGCAAACATTTGCGATGCCGCCATGCCCCGGGTCGGCCCCCGAGCACCACGTGGGGGTGCGTTCTGGTGGTCGCCCGAGATCGCAAGACTCCGCGAGGAGTGCGTGAGGGCGCGCCGCCGGAGCGCACGCCACCGCCGCCGCCGTCGTCGCGACGCTGCGTTCGCGGAGACGGCCCAGATGGACGCCACGTGGGGCACGCCTCCACGTCGCCCCAGCGTTCCCGCTGCCGAGGAGCCCCCTCCCCCTATCACGGGGGCGGAGATCCATGCGGCCGTGTCCAAAATGAGAGCGAAGGACACGGCCCCCGGCCCTGACGGCGTTCACGGCCGGGTCTGGAGCTTGGCCTTCGAGGCCCTAGGGGACCGGCTCGGGGGGCTTTTCGAAGCGTGCCTCGAGTCGGGACGGTTCCTGTCGAAATGGAAGACGGGCAGACTGGTCCTTCTGCGGAAGGACGGGCGCCCCGCGGACTCACCCGCGGGCTATCGCCCCATCGTGTTGCTGGACGAAGCGGGCAAGATGCTCGAGAGGATCGTCGCGGCCCGCATCGTCCGGCACCTGACCGAGACGGGTCCCGATCTTTCGGCGGAGCAATACGGCTTCAGAGAGGGCCGCTCGACTATCGACGCAATTCTGCGCGTGCGAGCCCTCTCCGATGAAGCCGTATCCCGGGGCGGGGTGGCGATGGCGTTATCCTTAGATGTAAGGAACGCCTTCAACACCCTGCCCTGGTCGGTGATCGCGGGGGCGCTGGAGTATCACGGCGTCCCCGCATACCTCCGCCGACTGATCGGCTCCTACCTCGAGGGCAGGTCGATCCAGTGCATCGGACACGGTGGGGCGATGTACCGCTTCCCCGTCGAGCGCGGTGTTCCGCAGGGGTCTGTCCTGGGCCCCCTGCTGTGGAACATCGGCTACGACTGGGTCCTGCGGGGCGTCATTCGGGGTCCCCTCCCCGGGCTGAGCGTAATTTGTTACGCCGACGACACGTTGGTCGTGGCTCCGGGGAGGGACTACCGGGAGTCTGCCCGTCTGGCGTGCGCAGGCGTGGCACACGTCGTCACAAGGATCCGACGGCTGGGACTCGAGGTGGCGCTCGACAAAACCCAGGCCCTGTTGTTTCACGGGCCGGGACGAGCGCCGCCTCTGGGTGCCCACCTCGTGATCGGAGGCGTCCGCGTCGGGGTCGGGGTGACCGGTCTTCGGTACCTCGGCCTTGAACTGGATGGTCGATGGAACTTCCGCGCTCACTTTGCGAAGTTGGGCCCTCGACTGATGGCGACGGCCGGCTCTTTGAGCCGGCTGCTTCCAAACGTCGGGGGTCCCGATCAGGTGGCGCGCCGCCTCTACATGGGGGTGGTGCGGTCGATGGCACTATACGGCGCGCCCGTATGGTGCCACGCCCTGACCCGCCAGAACGTTGCCGCGCTGCGACGTCCGCAGCGCGCGATCGCGGTCAGGGCGATCCGAGGATACCGCACCGTCTCCTTCGAGGCGGCGTGCTTGCTCGCCGGGGCGCCACCCTGGGACCTGGAGGCGGAGGCGCTCGCTGCCGATTACCGGTGGCGTAGCGACCTCCGCTCTAGGGGGGAAGGGCGCCCCGGCGAAGGAGTAGTTCGAGCGCGGAGGCTCCAATCTCGGCGGTCCGTGCTGGAGGCGTGGTCTCGCCGCTTGGCGGACCCGTCGGCCGGCCTCCGTACCGTCGAGGCGGTCCGTCCGGTCCTCGCGGACTGGGTGGGCCGCGACCGCGGATGCCTCACCTTCCGGCTGACGCAGATGTTGACCGGCCATGGGTGTTTTGGCCGGTACCTCTTTAAGATAGCCGGAAGGGAACCGACGGCGCAGTGCCACCACTGCGCGGACCGCGACGAGGAAGACACAGCGGAACACACGCTGGCGCGTTGCTCTGGATTCGACGAGCAACGCGCCGCCCTCGTCGCGGTCATTGGAGAGGACCTCTCGCTGCCGCGCGTCGTGGCTACGATGCTCGGCAGCGACGCGTCTGGTCCAGCGGGGTATTCCGGGACACCAGTGGCACCGTCTGGGCGGCCCGACGGGCTGCCGTACCGAGACGGCCGACGTTTTAGAGCCTTCAATTCGCCTCGAAGGCTCCGTCGGCTGGGCGTCCTTGGGGTGAGCCGCGCCGTCTGGTTGTAG
Protein
MALYGAPVWCHALTRQNVAALRRPQRAIAVRAIRGYRTVSFEAACLLAGAPPWDLEAEALAADYRWRSDLRSRGEGRPGEGVVRARRLQSRRSVLEAWSRRLADPSAGLRTVEAVRPVLADWVGRDRGCLTFRLTQMLTGHGCFGRYLHKIAGREPTAQCHHCADRDEEDTAEHTLARCSRFDEQRAALVAVIGEDLSLPRVVATMLGSDASWKAMLDFCESTISQKEAAERERESSSLSAPIRRRRAGGRRREYARTSRPLWALKRMNKELLMEAAAVAAWAPKPARLADVDAEVDWFRGTMANICDAAMPRVGPRAPRGGAFWWSPEIARLREECVRARRRSARHRRRRRRDAAFAETAQMDATWGTPPRRPSVPAAEEPPPPITGAEIHAAVSKMRAKDTAPGPDGVHGRVWSLAFEALGDRLGGLFEACLESGRFLSKWKTGRLVLLRKDGRPADSPAGYRPIVLLDEAGKMLERIVAARIVRHLTETGPDLSAEQYGFREGRSTIDAILRVRALSDEAVSRGGVAMALSLDVRNAFNTLPWSVIAGALEYHGVPAYLRRLIGSYLEGRSIQCIGHGGAMYRFPVERGVPQGSVLGPLLWNIGYDWVLRGVIRGPLPGLSVICYADDTLVVAPGRDYRESARLACAGVAHVVTRIRRLGLEVALDKTQALLFHGPGRAPPLGAHLVIGGVRVGVGVTGLRYLGLELDGRWNFRAHFAKLGPRLMATAGSLSRLLPNVGGPDQVARRLYMGVVRSMALYGAPVWCHALTRQNVAALRRPQRAIAVRAIRGYRTVSFEAACLLAGAPPWDLEAEALAADYRWRSDLRSRGEGRPGEGVVRARRLQSRRSVLEAWSRRLADPSAGLRTVEAVRPVLADWVGRDRGCLTFRLTQMLTGHGCFGRYLFKIAGREPTAQCHHCADRDEEDTAEHTLARCSGFDEQRAALVAVIGEDLSLPRVVATMLGSDASGPAGYSGTPVAPSGRPDGLPYRDGRRFRAFNSPRRLRRLGVLGVSRAVWL

Summary

Uniprot
ProteinModelPortal
PDB
6AR3     E-value=0.000296264,     Score=109

Ontologies

GO

Topology

Length:
1020
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.175100000000001
Exp number, first 60 AAs:
0.01215
Total prob of N-in:
0.00067
outside
1  -  1020
 
 

Population Genetic Test Statistics

Pi
48.613583
Theta
3.5406
Tajima's D
3.904471
CLR
0.001994
CSRT
0.99890005499725
Interpretation
Possibly Balancing Selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号