SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06428  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA011601
Annotation
Alanine--glyoxylate_aminotransferase_2?_mitochondrial_[Papilio_xuthus]
Location in the cell
Cytoplasmic   Reliability : 1.451 Mitochondrial   Reliability : 1.012
 

Sequence

CDS
ATGGCCAATAGAGGACGACTGTGCAATGTGGTTGGCAGGGCGTATAGTACAGCTAAAATGCCCTCCACCGGGTTTACACCCAAAGAGTATAAGGGCCCAACATACGAACAACTGGAACATTTGAAGTCGAAACATATGCCGCCAGCGATACCTAATTCTTACAAGAAGCCGGTGCTATTACACCAGGGTCACATGCAGTGGCTCTTCGACCACGAGGGCAAAAGATACTTGGACCTGTTCGGCGGAGTCGTTACTGTCTCAGTTGGAAATAGTCATCCGAAGCTAAACGCAGCTCTCAAAGAACAAATCGATTTAATATGGCACACGACGAACTTGTACCGGCATCCAAGAATATATGAATACATTGAGAAATTGTCGTCTAAATTACCCGATGATCTTAACGTCGTCTACTTAGTGAACAGTGGAACAGAAGCGAACGATCTGGCCACGATCCTGGCAAAGGCGTACACGGGTAACTTGGACGTGATATCACTCCAGACCAGCTATCATGGATACAACAGCAGCCTCATGGGGCTATCTGCTACACAGTCGTACAGAATGAACCTCCCCGTACCGCCGGGATTTTATCACGCGGCACATCCAGATCCGTACCGAGGGAGCTGGGGCGGCTGCAGAGACTCCATTTCGCAGGTGGCCGGCGCGTGCTCGTGTCCCGGCGAATGCGTTAGCACCGAAAAATACATTCATCAACTCGACGAGCTCCTAGGTAATTCTGTACCAGCCGGCAGAGTAGCAGCGTTCTTCGCGGAATCTATCCAGGGTGCTGGTGGAGTGGTGCAGTTCCCTAAGGGATACCTGAAGAGAGCTCAAGAGCTAATCAAGAAGAATGGCGGCTTGTATGTAGCTGATGAGGTCCAGACGGGTTTCGGTCGTACCGGAGACCACTACTGGGGCTTCGAGACACACGGCGTGAAGCCTGATATCGTGACGATGGCTAAGGGGATCGGCAACGGTTTCCCTCTGGCCGCTGTCGTCACCACTAAAGAGATAGCAGCCGCCCACAGCGGAAAATCGTATTTCAACACTTTTGGAGGAAACGCTTTGGCCGCAACAGTTGGAAAGGCCGTATTAGATGTTATTGACGAGGAAGAACTTCAAAAGAACAGCAAAACTGTTGGCGAATACTTCATCAGGCAGTTGATGGAGCTACAGAAGCAGCATCCAGTGATTGGCGATGTGAGAGGACAGGGCCTCATGATCGGGGTCGAGCTGGTCGAGCCTGGCACTAAGAAACCCCTGCCGGTGTCCCTTGTGAAAGATATACACGAAGAGATTAAAGACAATGGAGTTCTAGTCGTACTTGGCGGGCGGTGGAGTAATGTGTTCAGAATGAAGCCGCCGATGTGCATCACGAAGGCAGATGTTGATTTTGAGAAACACATCGAAATGGCTAATAGAGGAACAAAATTATGCTTCGACATCGTCAGAACGTACAGCACGGCCAAAATGCCGCCGACGGATTTCGTGCCCAGACCGTACACGGGACCTTCGTACCAACAAGTAGAACAAATGAAAGGAGTTTACATGCCGCCTTCAATCACGAACGCCTATAAGAAGCCGGTGCTTCTCACCCAGGGGCACATGCAGTGGTTATACGACAACGACGGCAAGAGATACCTGGATCTGTTCGGTGGAATCGTCACCGTCTCCGTGGGCCATTGTCATCCAAAAGTAAATGCAGCCCTCAAAGATCAACTCGATGTACTGTGGCATACGACCAACCTGTACAGACATCCGAAAATCTATGAGTACGTCGAACAATTAGCCGCTAAGCTCCCGGGGGATTTGAACGTGGTATATTTAGTGAACAGTGGATCAGAAGCTAATGAACTGGCGACTTTGCTGGCGAAAGCGTACACAGGAAACCTAGACATCATATCGCTGCAGACCAGCTACCACGGCTACACCAGCAGCCTCATGGGCCTGACGGCAACCCAGTCGTACAGGATGGCCATTCCCGTCCCTCCAGGTTTCTACCACGCAGTCCACCCTGATCCTTTCAGAGGCGCTTTCGGAGGCTGCAGGGACTCTATCTCGCAAGCTCCAGGATCCTGCTCGTGCACCGGAGAGTGCATCAGCACTGACAAATATGTCCACCAACTTAACGAGCTATTAGGTAACTCAGTTCCGGCCGGCAGAGTAGCGGCATTCTTTGCGGAATCCATTCAGGGTGCTGGTGGAGTCGTGCAATTCCCTAAGGGATACCTGAAGAAAGCTCAAGAGTTGATCAAGAAGAATGGTGGCTTGTATGTAGCTGATGAGGTACAAACAGGCTTCGGTCGCACTGGAGATCATTTCTGGGGCTTCGAGACGCACGGCGTGAAGCCCGACATCGTGACGATGGCTAAGGGGATCGGCAACGGATTCCCTCTGGCCGCTGTCGTCACCACTAAAGAGATAGCAGCCAATCACGCGAAGGCTGCCTACTTTAACACTTTCGGTGGAAACCCGATGGCTTCGACTGTTGGAAAAGCTGTATTGGAGGTTATTGAAGAAGAAGGACTGCAACAGAACAGTAAGGTAGTCGGCGAATACTTCATCAGGCAGTTGATGGATCTTCAGAAGCAGCACCCAGTGATTGGCGATGTCAGGGGACAAGGCCTCATGATCGGAGTGGAGCTTGTTGAACCCGGAACTAAGACACCGCTGACCACTTCCAAAGTTAATGATATCCATGAGAATATCAAAGACAACGGAGTGCTCATCGCTCGTGGTGGACGCTTTAATAATGTATTCAGAATAAAACCTCCAATGTGCATCACTAAACAGGACGTCGACTTCGGCATTTCGATCATCAATGATGCGATCAAAAAAGTTGTCAACTAA
Protein
MANRGRLCNVVGRAYSTAKMPSTGFTPKEYKGPTYEQLEHLKSKHMPPAIPNSYKKPVLLHQGHMQWLFDHEGKRYLDLFGGVVTVSVGNSHPKLNAALKEQIDLIWHTTNLYRHPRIYEYIEKLSSKLPDDLNVVYLVNSGTEANDLATILAKAYTGNLDVISLQTSYHGYNSSLMGLSATQSYRMNLPVPPGFYHAAHPDPYRGSWGGCRDSISQVAGACSCPGECVSTEKYIHQLDELLGNSVPAGRVAAFFAESIQGAGGVVQFPKGYLKRAQELIKKNGGLYVADEVQTGFGRTGDHYWGFETHGVKPDIVTMAKGIGNGFPLAAVVTTKEIAAAHSGKSYFNTFGGNALAATVGKAVLDVIDEEELQKNSKTVGEYFIRQLMELQKQHPVIGDVRGQGLMIGVELVEPGTKKPLPVSLVKDIHEEIKDNGVLVVLGGRWSNVFRMKPPMCITKADVDFEKHIEMANRGTKLCFDIVRTYSTAKMPPTDFVPRPYTGPSYQQVEQMKGVYMPPSITNAYKKPVLLTQGHMQWLYDNDGKRYLDLFGGIVTVSVGHCHPKVNAALKDQLDVLWHTTNLYRHPKIYEYVEQLAAKLPGDLNVVYLVNSGSEANELATLLAKAYTGNLDIISLQTSYHGYTSSLMGLTATQSYRMAIPVPPGFYHAVHPDPFRGAFGGCRDSISQAPGSCSCTGECISTDKYVHQLNELLGNSVPAGRVAAFFAESIQGAGGVVQFPKGYLKKAQELIKKNGGLYVADEVQTGFGRTGDHFWGFETHGVKPDIVTMAKGIGNGFPLAAVVTTKEIAANHAKAAYFNTFGGNPMASTVGKAVLEVIEEEGLQQNSKVVGEYFIRQLMDLQKQHPVIGDVRGQGLMIGVELVEPGTKTPLTTSKVNDIHENIKDNGVLIARGGRFNNVFRIKPPMCITKQDVDFGISIINDAIKKVVN

Summary

Pfam
PF00202   Aminotran_3
Interpro
IPR015424   PyrdxlP-dep_Trfase        + More
IPR015421   PyrdxlP-dep_Trfase_major       
IPR015422   PyrdxlP-dep_Trfase_dom1       
IPR005814   Aminotrans_3       
SUPFAM
SSF53383   SSF53383       
Gene 3D
ProteinModelPortal
PDB
5G4J     E-value=7.67724e-59,     Score=579

Ontologies

Topology

Length:
948
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0170099999999999
Exp number, first 60 AAs:
0.00137
Total prob of N-in:
0.00056
outside
1  -  948
 
 

Population Genetic Test Statistics

Pi
213.689639
Theta
184.930447
Tajima's D
1.091691
CLR
0.260541
CSRT
0.686965651717414
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
28556443 KPVLLTQGHMQWLYDNDGK 100.00 1e-10
26280517 TGAIVDVPVGEQIIGR 100.00 3e-10
26280517 TGAIVDVPVGEQIIGR 95.45 7e-10
28556443 TGDHFWGFETHGVKPDIVTMAK 100.00 3e-10
28556443 TGDHFWGFETHGVKPDIVTMAK 95.45 7e-10
28556443 SGSEANELATLLAK 100.00 3e-10
28556443 SGSEANELATLLAK 95.45 7e-10
28556443 SGSEANELATLLAK 100.00 3e-10
28556443 SGSEANELATLLAK 95.45 7e-10
26280517 MPPSPIPDVMIPEIDQVYR 100.00 5e-10
28467696 MPPSTFSQQQPQSYTPQNK 100.00 5e-10
26280517 TFVSGACDASAK 100.00 1e-09
26280517 TFVSGACDASAK 95.45 3e-09
26280517 DSIMAGIIVAGWDK 100.00 2e-09
26280517 DQIQETNSEYEKEK 100.00 3e-09
26280517 KFPDQQIFKPIPIIEK 100.00 3e-08
28556443 MAIPVPPGFYHAVHPDPFR 100.00 3e-08
28556443 KPVLLTQGHMQWLYDNDGK 100.00 3e-08
28556443 VVGEYFIR 100.00 3e-08
28556443 KPVLLTQGHMQWLYDNDGK 100.00 2e-07
28556443 IYEYVEQLAAK 100.00 2e-07
28556443 IYEYVEQLAAK 100.00 2e-07
26280517 IAGPAGYVATEAGFGSDIGMEK 100.00 1e-06
26280517 IAGPAGYVATEAGFGSDIGMEK 100.00 1e-06
28467696 VAAEVAAPISQAR 100.00 1e-06
28467696 VAAEVAAPISQAR 100.00 1e-06
28556443 VAAFFAESIQGAGGVVQFPK 100.00 1e-06
28556443 VAAFFAESIQGAGGVVQFPK 100.00 1e-06
28556443 TGDHFWGFETHGVKPDIVTMAK 100.00 1e-06
28556443 TGDHFWGFETHGVKPDIVTMAK 100.00 1e-06
28556443 TGDHFWGFETHGVKPDIVTMAK 100.00 1e-06
28556443 TGDHFWGFETHGVKPDIVTMAK 100.00 1e-06
26822097 SGADTIVACEAFQPMAECCIR 100.00 1e-05
26280517 SQFDVSGFPTIFWKPK 100.00 1e-05
28467696 AAYDYIQDQGIR 100.00 1e-05
28556443 FAESIQGAGGVVQFPK 100.00 1e-05
28556443 YVHQLNELLGNSVPAGR 100.00 1e-05
28556443 YVHQLNELLGNSVPAGR 100.00 5e-05
28556443 VVGEYFIR 100.00 5e-05
28556443 VAAFFAESIQGAGGVVQFPK 100.00 5e-05
28556443 AVLEVIEEEGLQQNSK 100.00 2e-04
28556443 AVLEVIEEEGLQQNSK 100.00 2e-04
28556443 YVHQLNELLGN 100.00 7e-04
28556443 YVHQLNELLGN 100.00 7e-04
28556443 AVLEVIEEEGLQQNSK 100.00 7e-04
28556443 AAYFNTFGGNPMASTVGK 100.00 7e-04
28556443 YLEDLKPVAK 100.00 7e-04
28556443 GIGNGFPLAAVVTTK 100.00 0.001
28556443 GIGNGFPLAAVVTTK 100.00 0.001
28556443 DNGVLIAR 100.00 0.001
28556443 DNGVLIAR 100.00 0.001
26280517 PAEQTPITAIYIAQIVK 100.00 0.005
28556443 MPPTDFVPR 100.00 0.005
28556443 LPGDLNVVYLVNSGSEANELATLLAK 100.00 0.005
28556443 GIGNGFPLAAVVTTK 100.00 0.006
28556443 GIGNGFPLAAVVTTK 100.00 0.006
28556443 GIGNGFPLAAVVTTK 100.00 0.006
28556443 GIGNGFPLAAVVTTK 100.00 0.006
28556443 GIGNGFPLAAVVTTK 100.00 0.006
28556443 GIGNGFPLAAVVTTK 100.00 0.006
28556443 GIGNGFPLAAVVTTK 100.00 0.006
28556443 GIGNGFPLAAVVTTK 100.00 0.006
28556443 GIGNGFPLAAVVTTK 100.00 0.006
28556443 GIGNGFPLAAVVTTK 100.00 0.006
28556443 GIGNGFPLAAVVTTK 100.00 0.006
28556443 GIGNGFPLAAVVTTK 100.00 0.006
28556443 GIGNGFPLAAVVTTK 100.00 0.006
28556443 GIGNGFPLAAVVTTK 100.00 0.006
28556443 DQLDVLWHTTNLYR 100.00 0.006
28556443 DQLDVLWHTTNLYR 100.00 0.006
28556443 DQLDVLWHTTNLYR 100.00 0.006
28556443 DQLDVLWHTTNLYR 100.00 0.006
28556443 FNNVFR 100.00 0.010
26280517 GVSGIIEVENPNR 100.00 0.025
28556443 GVYMPPSITNAYK 100.00 0.025
28556443 GVYMPPSITNAYK 100.00 0.025
28556443 GQGLMIGVELVEPGTK 100.00 0.025
28556443 GIGNGFPLAAVVTTK 100.00 0.025
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号