SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06392
Pre Gene Modal
BGIBMGA011929
Annotation
PREDICTED:_LOW_QUALITY_PROTEIN:_uncharacterized_protein_K02A2.6-like_[Papilio_machaon]
Location in the cell
Nuclear   Reliability : 1.66
 

Sequence

CDS
ATGAAGATTCTCCTTGCTATTGCATTAATATTGTCAACAGTAATGTGGGTGTCAACACAACAGCCACAAGGAGTGCACACGTACTGCGGGCGCCACTTGGCTCGCACTCTGGCCGACCTGTGTTGGGAAGCGGGCGTGGACAAGCGCAGCGGTGCTCAGTTCGCGAGCTACGGCTCCGCGTGGCTGATGCCGTACTCGGAAGGACGCGGCAAACGAGGCATCGTGGATGAGTGCTGTCTCAGACCCTGCAGCGTGGACGTGCTTCTGTCCATGCAAACTTGGAAGACTTGGAGATGCAGACTCACACAGTGGTTCATCGCGAACGATATTAACGTGGTGAAAGATCCAGCAGGAGTCAAAAGACGGGCCATATTGCTTAGCACACTCAGCGAATCTACCTACAAACTGGCAGCTGATCTCGTGCTGCCTAAAGAAGTTCAAGAAGTACCATACGAAGATATAGTTAGTGCCTTGGACAACCATTTCACTCCAAAATCAGTGGGATTTGGCGAGCGTCATCATTTTTATGCCGCCACACAACTACCCCAGGAGACACCATCACAGTGGGCTGCGAGGTTACGAGGTCTCACTTCTCAGTGTAACTTCAGCAATGTAGAAGAAGCATTAAGAGATCGATTCATTATGGGTATGCTGCCGGGCGTGGAGAAAGAAAAAATGTACGTGCAGGAGCTGGCCGGGCTGACCTTCGCCAGGGCTGTGGAGCTGACCGAGAGCTTGCGCAGCGCCCGCGCGGCTGCTGCTGCAAGCGCTGCTGCCGAGACTGTCGTTACAGAGCTGTACAAAATAGGCAAACGTTCTCCGACTAGTGTACCTCAAAGTGCAAAAGTAAAGTGTTCCGTGTGTGGTTATTCGAATCACAAAGCCGCGGAGTGTCGTTTTGCGAGTTACACTTGTAGGAAGTGCAACAAAAAAGGACATTTGCGTAGAATGTGCAAAAGAATCAATTATGTTGTAACGGAGGAGAACGATGAAGGTGACGGTGACGACGGTAAAATTTGTAACATTCGATCTTTGCGAGGTGAACCATTAATCGAAGCCGTGTGTGTCAATGGTATCAGAATGAACTTTGAGATTGATAGTGGGTCAGCTGTTACCGTTATGTCCGTAGATACATATAACGAACATTTTAAAAACATTCCCTTATTTAGCACAAATAAGAAGTTATTAAGTTACTCGGGTGACGTGTTAGGTTGCGCCGGTCGCGCTCAGTTGTTAGTGGAGTGGCGGGGTCGCACGCGCCAGCTCGACGTGTACGTGGTGCGCGATGGCGGACCGCCTTTACTGGGCCGCGACTTCATCGCACAATTTGAACTGCAGCTAGCGCCCGTATATAAATGTGCCACTACCCGTGACACGTTGAAATTAATACAGGAACAATATCCCGCCGTGTTCTCGGACAAGCTAGGTAAATTCAACAAATATAAAGTTAATTTGAAATTAAAAGAAAGTGCTCATCCTATATTTTTTAAACCACGGCCGGTCGCATTTGCTCTGCGTGAAAAAGTGGAAAAAGAGATAAACCGTTTGGTGGGACTGGGAGTACTCCGACCAGTCGAGCATTCCGACTACGCGTCACCAATAGTCCCGGTACTGAAACGTGACGGTTCGGTCCGTATCTGCGCGGACTACTCTGTTACTATAAACAAGCAATTAGTTGTAGAACAGTATCCGTTGCCTACCGTAAACGAGTTGTTTTCTAAACTATACGGGGGCCAGAAATTTACTAAATTAGATTTGTCTATGGCCTACGGTCAGTTTTGTCTGGATGAAGAATCCCAAAAGTTAACTTGTATCAATACGCATAAAGGGATCTTCGCGTATACGCGTTTGGTGTTCGGGTTAGCTAGTGGGCCATCAATTTTCCAGCGAGCCATGGATACAGTGCTAGCGGGCCTGGACGGCACGCTGTGTTTATTGGACGATGTGCTCATAACGGGTCGCAATGACTCTGAACATCTTGAGAGATTGCATCAGGTCCTAAAACGGTTGCAAGACGCAGGATTTGTTCTACAAAAGTCTAAATCTACGACCGACTCCGCCGCGCACTCCGGTGTGCCCGTGGGAATACCCCCACAACCCTTTTACCGTGTACACTTAGACTTTCTAGGTCCGCTGAATGGTCGGATGTACCTGGTCCTAGTAGACGCGTACTCCAAGTGGCTTGAGGTGTACGAGATGGCTTCCACAACTACTAGTGCGGTCATTGAAAGAATGTATGAGTACATGTCCAGATACGGATTGCCTCATACGGTAGTTACGGATAACGGTGTGATATTAAAGAGAATTGGTAAAAACGTATACATTGTAAAAGACTTTAAATCTTCAATACAACTCAAGAGGCACTCTGAACAGCTGTTTTCGTGCAAAACCAAATGTGGTGCCAGTCAAACCTGGGCGGATGACTTGAGCGGTTCTATTGCTCCAACCGTTGCTAGTCCGGCAACGGGGATGATGTCGTCGCCTTGTGATGATAGTAGCGGCATCGGACCTCACACACACGACGAAGAGAGTGCAACTGAGGAGAGGGAAGAGGAGAGCGGCCACACTGGAATCTCTAGTGCATGTGACAATCAGCCGAATCGGGAGTCACCGGAACCGAGTCACGTAACTGTCACGCGAGGAGTGCGTCGACCCGCGCAGTCTGAAGACTCTGAAGAAGGGGATCTGTTCTTCGAGGCAGAGGAGGTGAGCTTGGAGCCCCAAAATATTAGGGAGCCCAGGTTTCCTAAACGTAACCGTCCTAGGGTTAATTATAGACAGTTTTATTAA
Protein
MKILLAIALILSTVMWVSTQQPQGVHTYCGRHLARTLADLCWEAGVDKRSGAQFASYGSAWLMPYSEGRGKRGIVDECCLRPCSVDVLLSMQTWKTWRCRLTQWFIANDINVVKDPAGVKRRAILLSTLSESTYKLAADLVLPKEVQEVPYEDIVSALDNHFTPKSVGFGERHHFYAATQLPQETPSQWAARLRGLTSQCNFSNVEEALRDRFIMGMLPGVEKEKMYVQELAGLTFARAVELTESLRSARAAAAASAAAETVVTELYKIGKRSPTSVPQSAKVKCSVCGYSNHKAAECRFASYTCRKCNKKGHLRRMCKRINYVVTEENDEGDGDDGKICNIRSLRGEPLIEAVCVNGIRMNFEIDSGSAVTVMSVDTYNEHFKNIPLFSTNKKLLSYSGDVLGCAGRAQLLVEWRGRTRQLDVYVVRDGGPPLLGRDFIAQFELQLAPVYKCATTRDTLKLIQEQYPAVFSDKLGKFNKYKVNLKLKESAHPIFFKPRPVAFALREKVEKEINRLVGLGVLRPVEHSDYASPIVPVLKRDGSVRICADYSVTINKQLVVEQYPLPTVNELFSKLYGGQKFTKLDLSMAYGQFCLDEESQKLTCINTHKGIFAYTRLVFGLASGPSIFQRAMDTVLAGLDGTLCLLDDVLITGRNDSEHLERLHQVLKRLQDAGFVLQKSKSTTDSAAHSGVPVGIPPQPFYRVHLDFLGPLNGRMYLVLVDAYSKWLEVYEMASTTTSAVIERMYEYMSRYGLPHTVVTDNGVILKRIGKNVYIVKDFKSSIQLKRHSEQLFSCKTKCGASQTWADDLSGSIAPTVASPATGMMSSPCDDSSGIGPHTHDEESATEEREEESGHTGISSACDNQPNRESPEPSHVTVTRGVRRPAQSEDSEEGDLFFEAEEVSLEPQNIREPRFPKRNRPRVNYRQFY

Summary

Pfam
PF17919   RT_RNaseH_2        + More
PF00078   RVT_1
PF17921   Integrase_H2C2
PF00665   rve
PF00378   ECH_1
PF00098   zf-CCHC
Interpro
IPR000477   RT_dom        + More
IPR021109   Peptidase_aspartic_dom_sf       
IPR036875   Znf_CCHC_sf       
IPR041577   RT_RNaseH_2       
IPR041588   Integrase_H2C2       
IPR001995   Peptidase_A2_cat       
IPR012337   RNaseH-like_sf       
IPR001584   Integrase_cat-core       
IPR036397   RNaseH_sf       
IPR001878   Znf_CCHC       
IPR001753   Enoyl-CoA_hydra/iso       
IPR029045   ClpP/crotonase-like_dom_sf       
IPR001969   Aspartic_peptidase_AS       
SUPFAM
SSF57756   SSF57756        + More
SSF50630   SSF50630       
SSF53098   SSF53098       
SSF52096   SSF52096       
Gene 3D
PDB
4OL8     E-value=4.40735e-24,     Score=279

Ontologies

Topology

SignalP
Position:   1 - 19,         Likelihood:  0.997922
 
 
Length:
929
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.47014
Exp number, first 60 AAs:
0.46665
Total prob of N-in:
0.02455
outside
1  -  929
 
 

Population Genetic Test Statistics

Pi
231.318397
Theta
176.962094
Tajima's D
1.115792
CLR
47.753828
CSRT
0.693965301734913
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号