SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06391
Pre Gene Modal
BGIBMGA014205
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Extracellular   Reliability : 2.361
 

Sequence

CDS
ATGTCCCTTCGGAACAAGGTGACACTTTACAAAACTTGCATAAGGCCCGTCATGACTTACGCGAGTGTGGTGTTCGCTCACGCGGCCCGCACGCACATAGACACCCTTCAATCTCTACAATCCCGCTTTTGCAGGTTAGCCGTCGGAGCTCCGTGGTTCGTGAGGAACGTTGACCTACACGACGACCTGGGCCTCGAATCTATACAGAAATACATGAAGTCAGCGTCGGAACGGTACTTCGATAAGGCTATGCGTCATGATAATCGCCTTATCGTAGCCGCCGCTGACTACTCCCCGAATCCTGATCATGCAGGAGCCAGTCACCGTCGACGCCCTAGACACGTCCTTACGGATCCATCAGATCCAATAACCTTCGCACTAGACGCCTTCAGCTCTAGGAGCAGGCTTAGGGACCTCGTCCAACGTATTGGATTCGAATGTGATGTAAGCAAGACGGACTGGTTCTTTTATACTGAAAACCCCTTAATTACTATTCAATTAATCACACCTACACCAATCGCAGCTATATGTTCTACCTACACTCCCTACAGCCAGGTTATGTATGTAATGGAACGACCAAGTCGAGGCTGGGATGACGACAATGTAATGTGGGCGTCAACACAACAGCCTCAAGCAGTGCACACGTACTGCGGGCGTCACTTGGCCCGCACTCTGGCCGACCTGTGCTGGGAAGCGGGCGTGGACAAGCGCAGCGATGCTCAGTTCGCGAGCTACGGCTCCGCGTGGCTGATGCCGTACTCGGAAGGGCGCGACCAACGAGGCATCGTGGATGAGTGCTGTCTCAGACCCTGCAGCGTGGACGTGCTTCTGTCGTATTGTTAG
Protein
MSLRNKVTLYKTCIRPVMTYASVVFAHAARTHIDTLQSLQSRFCRLAVGAPWFVRNVDLHDDLGLESIQKYMKSASERYFDKAMRHDNRLIVAAADYSPNPDHAGASHRRRPRHVLTDPSDPITFALDAFSSRSRLRDLVQRIGFECDVSKTDWFFYTENPLITIQLITPTPIAAICSTYTPYSQVMYVMERPSRGWDDDNVMWASTQQPQAVHTYCGRHLARTLADLCWEAGVDKRSDAQFASYGSAWLMPYSEGRDQRGIVDECCLRPCSVDVLLSYC

Summary

Uniprot
ProteinModelPortal
PDB
1BON     E-value=8.15741e-10,     Score=151

Ontologies

Topology

Length:
280
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
2.75903
Exp number, first 60 AAs:
2.21015
Total prob of N-in:
0.16426
outside
1  -  280
 
 

Population Genetic Test Statistics

Pi
293.388357
Theta
165.105939
Tajima's D
2.498078
CLR
0
CSRT
0.943952802359882
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号