SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06361
Annotation
reverse_transcriptase_[Bombyx_mori]
Full name
RNA-directed DNA polymerase from mobile element jockey       + More
Probable RNA-directed DNA polymerase from transposon BS      
Alternative Name
Reverse transcriptase
Location in the cell
Mitochondrial   Reliability : 1.526 Nuclear   Reliability : 2.204
 

Sequence

CDS
ATGGCGCAAAACGCTAGAGAGAAACCATATTCCCTTACGTTAGCATTCTACAATGCTAACGGACTCGCGCGACAACGCGATCAAATTTACGAATTCCTCCGCGACAATCTTGTAGATATTCTGCTAGTGCAGGAGACCTGCCTGAAGCCCTCGCGTCGTGACCCGAAAGTCGCGAATTACGTCATGGTTAGGAATGACAGACTCACCGCCTCCAAAGGCGGGACTGCCATTTACTATAGGCGGGCCCTGCACGTTGTCCCTCTCGATACCCCCTCGCTCTCACATATCGAGGCGTCAGTGTGCCGTATCTCGCTGACGGGACACCAGCCGATCGTCATCGCATCCGTTTATCTCCCCCCGGACAAGCCCCTTCTGAGCAGTGACATCGAGTCACTGTTCGGCATGGGAGACTCCGTCATCCTGGCAGGCGATTTAAATTGCCACCACACTAGGTGGAACTGCCACAGTTCAAACATAAACGGTAGGCGTCTCGACGCGTTTATAGACGACCTTACCTTTGAAGTAGTCGGTCCCCCAACTCCAACATTCACAGCTACGAGGACCATGGTGGACTGGAAGAAGCTGGGCAAATGCTTAGCCGATGCCGCTCCACCAATCCTCCCCTGCGGCCCGGATTCAACTCCATCCCCCGAGGACACAGTCGAATCCATAAACATCATCACGGATCACATCTCTTCCGCGATCATAAGATCCTCAAAAGAAGTCGATGTGGAGGATAGCTTCCACCGCATCAGACTGTCCCCCGAACTTAGGAACCTCCTAAGAGTTAGAAACGCGGCAATCCTGGCCTACGATCAACTTCCCACGCACTCAAACCGGATTCGGATGCGTCGTCTACAGCGGGATGTAAAATCTCGCCTAAGCGACGCCCGAAATGAGAATTGGGATAGTTACTTAGAAGGACTCGCGCCCTCTCATCAAGCATACTGGCGACTAGCAAGGACTCTCAAGTCCGAAACTACCGCTACTATGCCTCCTCTCGTACGCCCTTCAGGCCAACCACCGGCTTTCGATGACGATGACAAGGCAGAGTTGCTGGCCGATGCACTGCAAGAGCAGTGCACCACCAGCACTCAATACGCGGACCCCGAACACACCGAGGCAGTCGACAGGGAGGTCGAGCGCAGAGCTTCCCTGCCACCCTCGGACGCGTTACCCCCCATTACCTCTGACGAAGTTAGAGAAGTAATAGACAACCTTCAACCTAAGAAGGCACCCGGCTCCGACGGCATCCGCAACCGCGCGTTAAAACTCTTACCAGTCCAACTGATAACAATGTTGGCTACCATCTTAAATGCCGCTATGACGCACTGCATCTTTCCGGCGGTATGGAAAGAAGCAGACGTTATCGGTATACACAAGCCGGGCAAACCGAATAATGAAACCGCTAGTTACCGACCGATTAGTCTCCTCCCAGCGATAGGCAAAATTTACGAACGGCTCCTTCGGAAACGCCTCTGGGACTTCGTTACCGCGAATAAAATTCTAATAGACGAGCAGTTTGGATTCCGCGCCAAACACTCGTGCGTACAACAAGTGCACCGCCTCACGGAGCACATCTTAATAGGGCTAAATAGGCGTAAACAAATCCCGACCGGCGCCCTCTTCTTCGATGTAGCGAAGGCGTTCGACAAAGTCTGGCACAACGGTTTGATCTACAAACTGTACAACATGGGAGTGCCAGACAGACTCGTGCTCATCATACGAGACTTCTTGTCGAACCGTTCGTTTCGATATCGAGTAGAGGGAACTCGTTCTCGTCCCCGTCATCTGACTGCCGGAGTCCCGCAAGGCTCCGCACTCTCCCCGTTACTATTTAGTTTGTATATTAACGATATACCCCGGTCTCCGGAGACCCATCTAGCGCTCTTCGCCGATGACACGGCTATCTACTACTCGTGTAGGAAGATGTCGTTGCTTCATCGGCGACTCCAGACCGCAGTAACCACCATGGGACAGTGGTTCCGGAAGTGGCGAATAGACATTAACCCCACGAAAAGCACAGCGGTGCTATTCAAAAGGGGTCGCCCTCCGAATACCACTTCGAGCACCCCACTCCCCAATAGGCGCGTAAACACCTCCGCCGTTAGCCCCATCACTCTCTTTGACCAGCCCATACCGTGGGCCCCGAAGGTCAAATACCTAGGCGTCACCCTCGACAGAGGGATGACATTCCGTCCCCACGTAAAAACGGTACGCGATCGCGCCGCGTTTATACTAGGACGACTCTACCCAATGCTTTGTAGACGAAGCAAACTGTCCCTCCGTAATAAGGTAACCCTCTACAAAACTTGCATACGCCCCGTCATGACGTATGCAAGCGTAGTGTTCGCTCACGCGGCCCGCACCAACTTGAAACCCCTTCAGGTTATACAATCCCGATTCTGCAGGATAGCCGTCGGAGCACCATGGTTCCAGAGGAACGTGGACCTCCACGATGACCTGGAGCTCGACCCCGTCAGTAAGTATCTACAGTCGGCATCGCTGCGCCACTTTGAGAAGGCGGCACGACATGAGAACCCTCTTGTCGTGGCCGCCGGAAACTACATACCCGATCCTGTAGACCGTTTGGTAAAGATCAGGATATTAAAGCTTGTAAGAGTAAGTCAAAGTATTCTTCTCTAG
Protein
MAQNAREKPYSLTLAFYNANGLARQRDQIYEFLRDNLVDILLVQETCLKPSRRDPKVANYVMVRNDRLTASKGGTAIYYRRALHVVPLDTPSLSHIEASVCRISLTGHQPIVIASVYLPPDKPLLSSDIESLFGMGDSVILAGDLNCHHTRWNCHSSNINGRRLDAFIDDLTFEVVGPPTPTFTATRTMVDWKKLGKCLADAAPPILPCGPDSTPSPEDTVESINIITDHISSAIIRSSKEVDVEDSFHRIRLSPELRNLLRVRNAAILAYDQLPTHSNRIRMRRLQRDVKSRLSDARNENWDSYLEGLAPSHQAYWRLARTLKSETTATMPPLVRPSGQPPAFDDDDKAELLADALQEQCTTSTQYADPEHTEAVDREVERRASLPPSDALPPITSDEVREVIDNLQPKKAPGSDGIRNRALKLLPVQLITMLATILNAAMTHCIFPAVWKEADVIGIHKPGKPNNETASYRPISLLPAIGKIYERLLRKRLWDFVTANKILIDEQFGFRAKHSCVQQVHRLTEHILIGLNRRKQIPTGALFFDVAKAFDKVWHNGLIYKLYNMGVPDRLVLIIRDFLSNRSFRYRVEGTRSRPRHLTAGVPQGSALSPLLFSLYINDIPRSPETHLALFADDTAIYYSCRKMSLLHRRLQTAVTTMGQWFRKWRIDINPTKSTAVLFKRGRPPNTTSSTPLPNRRVNTSAVSPITLFDQPIPWAPKVKYLGVTLDRGMTFRPHVKTVRDRAAFILGRLYPMLCRRSKLSLRNKVTLYKTCIRPVMTYASVVFAHAARTNLKPLQVIQSRFCRIAVGAPWFQRNVDLHDDLELDPVSKYLQSASLRHFEKAARHENPLVVAAGNYIPDPVDRLVKIRILKLVRVSQSILL

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Miscellaneous
Prefers poly(rC) and poly(rA) as template and activated DNA is not effective.
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  RNA-directed DNA polymerase from mobile element jockey
EC Number
2.7.7.49
EMBL
U07847    AAA17752.1    AB055391    BAB21761.1    AB018558    BAA76304.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    GEZM01008457    JAV94772.1    KQ973342    KXZ75569.1    KQ971729    KYB24751.1    GALX01005359    JAB63107.1    GALX01005299    JAB63167.1    GBBI01004395    JAC14317.1    KQ973412    EFA12510.2    GBBI01004571    JAC14141.1    ABLF02042518    ABLF02057746    GGMS01002992    MBY72195.1    RPOV01000134    RPJ78669.1    S59870    AAB26437.2    GGFJ01001858    MBW50999.1    GGFJ01001857    MBW50998.1    GGMS01006359    MBY75562.1    GFTR01008038    JAW08388.1    KK119692    KFM76444.1    NEVH01006736    PNF36716.1    GFTR01008271    JAW08155.1    GGMR01000676    MBY13295.1    GGMR01003407    MBY16026.1    GFTR01008261    JAW08165.1    ABLF02008153    ABLF02008462    ABLF02008464    GFTR01008256    JAW08170.1    GGMR01012305    MBY24924.1    GFTR01008251    JAW08175.1    NEVH01011985    PNF31054.1    GFXV01000908    MBW12713.1    NEVH01021205    PNF19912.1    GGMS01017365    MBY86568.1    ABLF02022418    NEVH01027074    PNF13841.1    NEVH01016302    PNF25823.1    NEVH01009134    PNF33528.1    GFTR01008269    JAW08157.1    NEVH01020940    PNF20481.1    GBGD01000415    JAC88474.1    ABLF02023911    GGFJ01001844    MBW50985.1    GGFJ01001842    MBW50983.1    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    GGFJ01001843    MBW50984.1    ABLF02034467    GFXV01002840    MBW14645.1    GGMR01016296    MBY28915.1    GBGD01000389    JAC88500.1    GFTR01008151    JAW08275.1    GFTR01008260    JAW08166.1    GGMR01006408    MBY19027.1    GGMR01016905    MBY29524.1    GGFJ01001822    MBW50963.1    GFTR01008254    JAW08172.1    M22874    M38643    GGFL01005122    MBW69300.1    NEVH01026386    PNF14434.1    GGMR01013409    MBY26028.1    GGMR01003864    MBY16483.1    GGFL01005121    MBW69299.1    GEZM01084969    JAV60363.1    GFTR01008257    JAW08169.1    GEZM01053022    JAV74219.1    GFXV01007093    MBW18898.1    GGMR01012443    MBY25062.1    NEVH01005295    PNF38784.1    M95171    AAA29354.1    GGMR01011511    MBY24130.1    AY060438    AAL25477.1    NEVH01022639    PNF18527.1    ABLF02040174    ABLF02040183    ABLF02055266    AY180919    AAN87272.1    GECL01003538    JAP02586.1    GGFJ01002256    MBW51397.1    GGMR01012283    MBY24902.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    X17551    CAA35587.1    GBBI01003747    JAC14965.1    GGMR01000226    MBY12845.1    GGFJ01002257    MBW51398.1    M38437    ABLF02016613   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
SUPFAM
SSF56219   SSF56219       
Gene 3D
PDB
6AR3     E-value=0.016256,     Score=93

Ontologies

Topology

Length:
881
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.404130000000001
Exp number, first 60 AAs:
0.00127
Total prob of N-in:
0.01063
outside
1  -  881
 
 

Population Genetic Test Statistics

Pi
13.78297
Theta
3.414605
Tajima's D
0.79752
CLR
257.778612
CSRT
0.635368231588421
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号