SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06356
Annotation
PREDICTED:_RNA-directed_DNA_polymerase_from_mobile_element_jockey-like_[Amyelois_transitella]
Location in the cell
Mitochondrial   Reliability : 1.121 Nuclear   Reliability : 1.655 PlasmaMembrane   Reliability : 1.053
 

Sequence

CDS
ATGGATCTGTACACTAAGTTACAAGAGGTGGAATCAAGCGTTGTGCAGAGGATGACTGAGTTTGAAGCAATGCTGAGCAGTCACCAGTCACCACACACGGACCTAGGCAAGTTGTCACAAGATTTCATCGCATTCCGGAATCTCACACTACAAACACTCAACATGCTGAGGTCACAGATGGAGCTTGTTCTCTTGGGGTTGGACAGGCATGAGATGGCGTCGCGTCGTAAGGTCCTTCTGTTTCATGGAATCCCGGAGTCAGATGCCACAGACCCAGCAACAGCAATTGTGGGTATATTAACCAACCAAATGAAGGTGGCTGGTTGCACAGAAGAGGACTTAACTGCTTGCTATCGGTTAGGCTCCAACACCAATAAGCCTAGGCCTATATTAGTCAGGTTCATGAGTTTGAGGCGATGCAATGAAGTGTGGAAGAACAAGACACTCCTGAAGGGTTCTAGGGTCATCATTTCAGAATTTCTGACCAAATCACGTCATGATGTCTTTTTGGAGGCCCGCTCTCATTTCGGCGTTAAGCGCTGCTGGACAACAGATGGGAAAATAATCGTCCTTCTCCCGGATAATAAACGCAGTAAGATTGAACAGATGTTTGAACTTCAGCATCTGAAAACCAAGTTTCCCTCGGCTCAAAAAGCGCAAGGAGCTCCTCAGTCATCTGGGAAATCTCATGACGAACCCAAGACGGCACCAAAATCAGCGGCAGAGCGAGAAATCGGCAAGAGGACGACTCGTCGAAAGTACTTCAAGGGTATAGGCGTGGAGCGATTGCGGGCTGACGCGAGGAATGTTGACTGGTCGACTGTCTTCGGCTCTGACACGATCGATGACATGTCTGGTTTCCGCCAAGGCCACAGCACGGTCACTGCATTGCTCAAGGTCACTGACGACATTCGCCACGCGATTGATGTGGGGCAGCTAACCGTGTTGACCTTATTGGACTTCAGCAGTGCTTTTAACTCAGTAGACTTTGACATCCTTCTAAGTATCCTTGGATCTCTTAATGTATCTCCACTTGCCCTAACCTGGTTTGAATCTTATCTCCGGGGACGCTCGCAGTGTGTCCGTTCTGATGATGCTACTTCAAAATGGTGTGATTTAACTGCGGGTGTACCTCAAGGTGGCGTACTATCCCCTCTCCTTTTCTCTATTTTCATTAATGAAATTACTCAGGTGCTGACTTCTCACTACCATCTCTACGCTGACGATTTGCAGATTTATAGACATTTTAAAGCTGATGACGTTGCTCTAGCTATTGCTGAAATCAATGGAGATCTTGGTAGAATTAGTGCTTGGGCTAAATCTTTTGGACTTCTTGTGAATCCATCAAAATCACAGGTCATAGTAATTGGTAGTTCCTATAGGTACAACACGATTGACCACATTAATTTGCCCCCTGTGACGCTAGATGGAATTCCAATCGCTTATTCTAAAACAGCAAAAAACCTAGGTATCGTTCTTGATTGTCATCTCTCTTGGTCCAGTCAGATAAACTTAGTTAGCAGGAAAGTGCATTGCACGTTTCAGTCTCTCAAGCGTCTTCAGCGTTTCTTGCCCTTTGAAGCTAAAGTCACCCTGGCCCAATCCCTTATGCTTCCTCTCCTTGACTATGCAGATGTCTGTTTCCTGGACGCCGCGGAGGGGCTGTGGGACAAACTGGAAAGGTTACAAAATTTATGCATACGCTTTATTTTTGGTTTACGCAAATATGATCATGTCTCGCAGTACAGATCACAACTTAATTGGTTACCTATCCGACTTCGCCGTGATGTACATGTTTTATGTATGCTGTTCAACATCCTTAATAACCCAGCTGTTCCCCGGTACCTCCGTGAGCGCTTCGAGTACCAGATGCCCCGAGGTGTACCCTGTCGTACAAGTAGATCCCTTCTCCTTAATTTTCCCCCTCACTCCTCCAGCCGCTACGGCGGTTCGTTCACTGTGCAGTCTGTGCGTCTGTGGAACTCAGTTCCACACTCAATCCGTGCAAGTCCCTCACTTGAGGTATTCAGGAAGGCATTAAAGAAGCACTATCTATCTATTTAG
Protein
MDLYTKLQEVESSVVQRMTEFEAMLSSHQSPHTDLGKLSQDFIAFRNLTLQTLNMLRSQMELVLLGLDRHEMASRRKVLLFHGIPESDATDPATAIVGILTNQMKVAGCTEEDLTACYRLGSNTNKPRPILVRFMSLRRCNEVWKNKTLLKGSRVIISEFLTKSRHDVFLEARSHFGVKRCWTTDGKIIVLLPDNKRSKIEQMFELQHLKTKFPSAQKAQGAPQSSGKSHDEPKTAPKSAAEREIGKRTTRRKYFKGIGVERLRADARNVDWSTVFGSDTIDDMSGFRQGHSTVTALLKVTDDIRHAIDVGQLTVLTLLDFSSAFNSVDFDILLSILGSLNVSPLALTWFESYLRGRSQCVRSDDATSKWCDLTAGVPQGGVLSPLLFSIFINEITQVLTSHYHLYADDLQIYRHFKADDVALAIAEINGDLGRISAWAKSFGLLVNPSKSQVIVIGSSYRYNTIDHINLPPVTLDGIPIAYSKTAKNLGIVLDCHLSWSSQINLVSRKVHCTFQSLKRLQRFLPFEAKVTLAQSLMLPLLDYADVCFLDAAEGLWDKLERLQNLCIRFIFGLRKYDHVSQYRSQLNWLPIRLRRDVHVLCMLFNILNNPAVPRYLRERFEYQMPRGVPCRTSRSLLLNFPPHSSSRYGGSFTVQSVRLWNSVPHSIRASPSLEVFRKALKKHYLSI

Summary

Uniprot
ProteinModelPortal
PDB
5IRG     E-value=0.000250898,     Score=108

Ontologies

GO

Topology

Length:
687
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.11952
Exp number, first 60 AAs:
0.0005
Total prob of N-in:
0.00109
outside
1  -  687
 
 

Population Genetic Test Statistics

Pi
24.897677
Theta
189.882917
Tajima's D
0
CLR
0.002177
CSRT
0.366131693415329
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号