Gene

KWMTBOMO06355  Validated by peptides from experiments

Pre Gene Modal

BGIBMGA011982

Annotation

PREDICTED:_low-density_lipoprotein_receptor-related_protein_2_[Amyelois_transitella]

Location

Bomo_Chr11(-):5428580-5468117      View in EpiBrowser

Full name

Low-density lipoprotein receptor-related protein 2       + More
Low-density lipoprotein receptor-related protein      
Prolow-density lipoprotein receptor-related protein 1      
Low-density lipoprotein receptor-related protein 1      
Low-density lipoprotein receptor-related protein 1B      
Low-density lipoprotein receptor-related protein 4      
Low-density lipoprotein receptor-related protein 6      
Low-density lipoprotein receptor-related protein 5      
Vitellogenin receptor      
Putative vitellogenin receptor      
Very low-density lipoprotein receptor      
Low-density lipoprotein receptor-related protein 8      
Low-density lipoprotein receptor      
Low-density lipoprotein receptor 1      
Low-density lipoprotein receptor 2      
Sortilin-related receptor      
Pro-epidermal growth factor      
SCO-spondin      
G-protein coupled receptor GRL101      
Nidogen-1      
LDL receptor repeat-containing protein egg-1      
Atrial natriuretic peptide-converting enzyme      
Basement membrane-specific heparan sulfate proteoglycan core protein      
Suppressor of tumorigenicity 14 protein      
Suppressor of tumorigenicity 14 protein homolog      
Low-density lipoprotein receptor-related protein 12      
Low-density lipoprotein receptor class A domain-containing protein 3      
Modular serine protease      
MAM and LDL-receptor class A domain-containing protein 1      
Serine protease nudel      
Low-density lipoprotein receptor-related protein 3      
Transmembrane protease serine 7      

Alternative Name

Glycoprotein 330
Megalin
Alpha-2-macroglobulin receptor
Apolipoprotein E receptor
Low-density lipoprotein receptor-related protein-deleted in tumor
Multiple epidermal growth factor-like domains 7
LDLR dan
Low-density lipoprotein receptor-related protein 7
Protein yolkless
Vitellogenin receptor
Apolipoprotein E receptor 2
Protein LR8B
Gp250
Low-density lipoprotein receptor relative with 11 ligand-binding repeats
SorLA-1
Sorting protein-related receptor containing LDLR class A repeats
Entactin
Corin
Heart-specific serine proteinase ATC2
Pro-ANP-converting enzyme
Transmembrane protease serine 10
Perlecan
Matriptase
Membrane-type serine protease 1
Prostamin
Serine protease 14
Serine protease TADG-15
Tumor-associated differentially-expressed gene 15 protein
Epithin
Suppressor of tumorigenicity 7 protein
Low density lipoprotein receptor-related protein 4
105 kDa low-density lipoprotein receptor-related protein
Matriptase-3

Location in the cell

Extracellular   Reliability : 3.053

CDS

ATGTTCCGGTGTCCAGAGGGTAAATGCATCCCTTCGCTGTGGGTGTGCAACTACCAGAAGGACTGCGATAAGGGCGAGGACGAATTCCAATCTTGTCCTCCTCCGGAGTGCGACGCAGGGCAGTTGTCTTGCAATCAGTACGTGTGGAACAAGACGTATTGCATCCCCCCGCACTACCGCTGCGACATGCACGTGGATTGCGTGGACGGCTCCGACGAGGCTGACTGCACGTACCGAAAATGCCAAGCTGATGATTTTCAGTGCGGCATGGAGGGCACGGGGAAGGTGTCGTCACAAGGACCTTGTGTAACAAAGGAGAAGAAATGTGATGGGTATTTAGATTGTAGAACCGGTAAAGATGAGCAAGATTGTCCGGGGCAGAGCATCGCGTGTCGCCTCGATCAGTTCAGGTGCGCTTCTGGCAACAAATGTGTCGATGCATCAGCTAAATGTGACCACAAGGACGACTGCGGAGATAATTCTGATGAGGCACATTGCAGTTTCCCACCGTGTCACATTGGACAATTCCGATGCAGCAATGCTCTTTGCATCCCCGCGAACTATCACTGTGACGGCTACAATGACTGCGCCGACGGTTCCGACGAAGCCAACTGCACTGCCATAGCCTGCCCTGATAATCAGTACCTATGTCCCAAGGGAGGCCCAGGGGGAGTGCACAAGTGTATAGCTAGATCACAGCTCTGTGACGGAAAGAAGGATTGCGAAGATAAGGCTGATGAAGAAGACGCATGCTCCATATTATCATGCCCAGCGTTGGGATGCGAGTACAAATGCGTGGCGTCGTTAGCGGGGGGTGCGTGTTCTTGCGCGGCGGGACTAATGCTGTCCGCAGACAACAGGACCTGTGTGGACCGCGACGAATGCAAGGAGTGGGGCTACTGTCACCAGCTTTGTGTCAATACTTTAGGATCATACAAGTGCCAGTGTGCTCCGGGGTACTCGTTGGTGGACGGCAAGCGGTGCTCGGCGGGCGTGGCTGCTTCGCCTTGGCTGGTGCTGGCGCACGCGGGCGCCGTGCTGCGTATGGACCTTCACGGCCGCGCGCCGCAGACACTCGCCAACGCCACCGCCGCTGCTGGACTCGACTACCACTACCGCAGGAACTTGCTATTCTGGTCCGATCTAAAAACTAGAAAGATCCACTCTCAACAACTAAGCGCTCCGGCAGGGCTGGGTAGGTTCGGCGACGCAGAGATCTCCGTGGCGGGGTCGTGGGCGCCGGTAGCGCTGGCTGTGGACTGGGTGGGCGACAAGCTTTACGTGGCCGACTCGCTCGGACAGAAGGTCGACGTGTTCGAGCTGGACGGCCGCTGGCACGCCGTGGTGCTCGGGTCCAACCTCACCAGCCCGGCCGATCTAGCACTCGATCCTACTTTGGGACTCATGTTCGTTGCTGATAGCAGTCAGATAATACGAGCAAACATGGACGGCACTCACATGAAGGCCATTGTTTCCGAAGCTGCGTACAAAGCGTCAGGAATAGCAGTGGATATAATCGCACGCAGGGTGTTCTGGTGCGACTCGCTACTGGACTACATCGAGACCGTCGACTACGACGGAAACCACAGGTTCCTCGTCCTCAGAGGTCAACAGGTGCCCAGTCCGTCTAGACTGGCACTCTTCGAAGACAGAGTGTACTGGTCGGACAGCACCAAACAGGGTATAAGCTCCGTCAATAAGTACGGCGGGGCGTCCAGTATTCAAGCCATATACAAAATGAAAGACATCAGGGACCCCAAAGCTATCACTGTGATACATTCTCTAAAACAAACCTCGGTCAACAACCCTTGCGGAACCAACAACGGGGGGTGTTCGCAGATGTGTATAGTCACTGCGCTTCAAAATGGAGGATTAGGATACAGATGCGCTTGCAACATCGGATACAGGCTCGAGACTGATCTGCGCAACTGTGACATCGTTAACGAATTCCTTATGTATTCTCAACAAAGATTTATCAAAGGAAAGGTATTGAATCCTGTGATAGAAGGTTTCAGTGACGCCATACTGCCAGTTGTGTCCAGGAGAGCGAGATTCGTCGGTTTGGATTTCGACGCGAGGGACGAACACATCTACTACTCTGACGTGTTACAGGATGTCATTTACAGAGTTCACAGGAATGGAACTACCAGGGAAATCGTGTTAGCATCGCAAAACGAAGGGGTCGAAGGACTGGCGGTGGACTGGGCTTCCAAAAACTTGTATTACATTGACTCCAGAAAAGGAACTTTAAATGTACTATCAACAAGGAATATTGCTTATAAAAGAACATTATTGAAAGATCTGAAAAGACCAAGAGCAATCGTCGTCCACCCTAACAAAGGGTTCATTTTCTTCTCGGAGTGGGATCGTCCTGCCAACATCAGTAGATCTAATACAGACGGTACTGGTCTTCTAGTCTTCGAGAATGTAACCCTCGGCTGGCCAAATGGACTGTCCATAGACTTCGACACGGATCGACTGTACTGGTGCGACGCGCTATTGGATCACGTACAGCATTCCAAGCTGGACGGAACTGACGTCAAGACTGTCAGTTCACGATTGATCAGGCATCCATTCTCGATTGTTATCCATAAAGAATTCATGTACATCACCGACTGGAGACTTGACGCAATCGTGAGGTTACACAAGTTGACTGGTGAACAGGAAGACATCATGGTAAGGGAGCCGCAAACAAACAGGCTATATGGCGTTAAAGTTTACAGTGAAAAAATCCAGAAGATAGACCCGATGCAACCTTGTGCGAGAAATAACGGAAACTGCCAGAAACTATGTTTCGCTATACCTAGAAACAATACAGAGTTTTTGACGGTCAAATGCGGTTGTCCGTACGGTGAAAAGTTGGCGGCGGACGGTCAGACCTGTGAATCTGATCCGAACTCGGAGCCTCCGGTGCAGGCGTGTCCGCAGTCCTGGGATTTCACGTGTAACAACCAGCGGTGCATTCCGAAGAGTTGGGTCTGCGATGGCGACGACGACTGCCTCGACAACAGCGATGAAGAACAAAACTGCACCAAGGCTACGTGTGGCCCCAGAGAGTTCATGTGCAAGTCTGGGCGGTGCATCTCCGACATGTTTCGCTGCGACTCCGAGAACGACTGCGGAGACTTCTCCGACGAGACCGGCTGCGTCAACGTGACCTGCAGCAGCGCTCAGTTCCAGTGCGACAACGGGCGCTGCGTGCCCTCCACCTGGAAATGCGACTCCGAGAACGACTGCGGAGACGGCTCGGACGAAGGGCCACACTGTGCCGAGAAAACTTGCGCATATTTCCAGTACACGTGTCCTCGGACCGGGCACTGCATCCCGGCCTCGTGGGTGTGCGACGGTGACGACGACTGCTTCGACAAGCAGGACGAGGCGGACTGCCCTCCGGTCTCGTGCCTCCCCAACCAGTTCAAGTGCGCCGATCTCAAGCAGTGTGTGCTGGAGGTGTACAAGTGCGACGGCATCCCCGACTGCAACGACGGCAGCGACGAGCTGGGCTGCCCGTCGCTGGCGCCGCACCAGTGCCAGCCCGGGAAACAGTTCCAGTGCCGCTCCTCTGGGATCTGCATACCCTCCACTTGGCATTGTGACGGTACGCCGGACTGCGAGGACCTCTCCGACGAGCCGGCCTCCTGCGGCACGGTGGAGTGCGCCCCCAACTACTTCCGCTGCGACAACGGACGATGCATCTTCAAGACGTACGTCTGCGACGGAAATGATGATTGCCAGGATGGGTCTGATGAAGGACTCCAACATGCTTGCAAAGCGCCGCCTTTCCGCTGTCCATCCGATCAATGGGAATGTCCTCAAGCATCAGGCCGCTGCATCAATTTCACTCAAGTGTGCGATGACAAATTGGATTGTCCGGGTGGCACCGATGAAGGTCCGGTGTGCTCGGAGAAGCAATGCTCGTGGCGCGGGGCCCAGTGCTCGCACGGGTGCCACGAGACGCCGGGCGGCGCGCAGTGCGTGTGTCCGCGCGGCCTGCAGCTGACCCCGGGCGAGCCCGACGCCGCCACGTGCTCCGACCTGAACGAGTGCGAGCCGCCCGGCGTCTGCTCGCAGCTGTGCACCAACACGAAGGGCTCGTACGCGTGCGGCTGCGTGGCCGGCTACCGACTGGCACTCGACGCGCACTCCTGCAAAGCGGACAACCATTCCGGCGCCTTCCTAATAATCTCCAACCGCCACTCGATCCTGGTAGCCGACCTCGACGAGCAAGGCCTCGAGCGGGTGCCCATCGACGTTGAGAACGTGGTCGCCACCGCCTCCGACATGCACACGGGTACCATTTTCTGGTCCGACATGAAGCTGAAAAAGATCTCCCGCCTGGACCGCGGCGGCGAGCCGAAAGTTATCGTCTCAACGGGACTTGATCTAGTCGAGGGACTCGCGTACGATTGGGTCGGCGGCAACGTGTACTGGCTGGACAGCAAACTGAACACCATCGAGGTTGCGAAAGAGGACGGAGCGGCTCGGACGACTCTGCTGAGCGGTAACATCACGCAGCCGAGAGGGATGTGTCTCGACCCGGCTCCGGACGCGAGGTGGCTGTTCTGGACCGACTGGGGCGAGCATCCCAGAGTCGAACGGATCGGCATGGACGGGACCCGACGAATGGCGATCATTACTACTAAAATATACTGGCCAAACGGCCTCACGCTCGACACGGCCACGAAGAGGGTCTACTTCGCTGATTCCAAATTAGACTTCATAGATTTCTGCAACTACGACGGCACGGGTCGCCAGCAAGTGTTGTCGGGCAGCCATTACTTGCTGCATCCCCACTCACTCACACTCTTCGAGGACACGCTGTACTGGACCGACCGTCAGTTGAACCGAGTGCTGTCGGCGCACAAATTCAAGGGTTCGAACCAGACGGTGGTGTCGCACCTCATCTCGCAGCCGCTGTCCATCCACGTGCACCACCCCTCGCTGCAGCAGCAGTACACGTCGCCCTGCAAGCGCGACACGTGCCAGCATCTGTGTCTCCTGAGTCCCAACCAGACGGTCGGCTACACGTGTATGTGTCAACCGGGGTATAAGCTCTTGCAGGATGGAAAATGTGCAGACGAAGAAACAGCCTATTTGATGGTACTGAAGGGCACTCAAGTCATCGACCTCTCCACTGACGGCTCAGGAAGAGCTGGACAACTGTCGCCGGTGGTTGGTATACAAGGTGGTATCCAATTGGACTACGACCGTCAAGGACACACGCTGTACTGGCTCCAGTCCATCTCAGGAGACAGTGAGGATGATGAAAACTGCACCATATACACTATGCCATACGGTGGTGGCAATAAGGCTGAATTTTTAGGCCGAGACACCGGCATTGTTGGTGCACCATCTTCGATTGCTTTCGATTGGATTGGAAGGAACTTATACATTGCAAATAGAGTTGCCAGTAATATCGAGTTGATCAAAGTAGACGGCAAAGTTAAGTACAGAACCATCGTGATGGCAAACGATGGTGGTAAGATGTCCGTGGCAAAACCCAGAGCTTTGGCACTTGATCCTACAGAAGGTAAAATGTACTGGTCTGATGAAGGTGGTTACGGAGTTCCCCCAAAAATTGGGAAAGCAAACATGGACGGCACCAATTCTATCATTTTGGTAGATACTATTGAAAGACCGGAGGCCATCACCATCGACATTGAGAGAAAGATTGTCTATTTCAGCACTCAGTACCCCGCCACCGTCATCAGTGTAAACACAGATGGAAATGACAGAAAAACTATACTCGACGAATCAAATGGTATCTCGTATCCAAAAGTGATCGCTGTACTTGACTTGAGGCTGTACATACTTGATCCGAGACACGAGAAGATCATCCAAGCCGATCTCCCCAACGGAGACAACATCAAAACGATTATTGACAATGAAAGTGATTTGAAATCTTTTACAATTTTCCAAAAAAGGAAGATGATTCATCATCCTTGTTCTCAGAGCAACGGAGGCTGCGAACAGATCTGTATTCCAGGTGACGACAGCGTGTCTCGGGTGTGTGCTTGTTCTATCGGCTACAGAAAAGAGAACGAGATTCATTGTGTTCCTTATAAGACGTTCGCAGTAGTCTCTCAGCTAGATTTAATCCGAGGGTACAGCCTCGATACTAGCGCAGAAGCGATGGTACCCATTACCGGTTCTGGACATCATATCCTACACGTAGACGTTCATTTCGCCGAAAATTATATTTACTGGGTCGAGTTCAACAGAGGTCAGTGGAACGGAGTTTTCAGGATACGTCCAAATGGTACAGAACTGCAACACATCATTAAGGATGGAATCGGAAGCAATGGCATTAGAGGCTTAGCCGTCGATTGGGTTGCAGGTAATCTATACTTCACAAATGTATTTCCGCACGAAAGCTACGTGGAAATGTGCTGGTTGGACGGTTCGAACCGAAAAGTCCTCGTGAAAACAACAATGGACGCCCCAAGGGAATTAGCCGTTAACCCGATATACCGGTTTTTGTACTGGATCGATTACGGGCAATACCCTCGCATTGGCCGAGCGTATCTCGATGGGAGTCAATGGAATACATTAGTCAGTTCCGGGATATCGAATCCTCGAGATTTGACCATCGACATGTTGACTCATGATGTGTACTGGGTAGATTCTAAATTAGACCAAATTCAAAAGATTTCGTACAGCGGCGGCAACAGACAGGTGATCAGATCAAATTTACCCAACCCGATGGGCATAGCGGTCCACACAGGTAGCGTCTACTGGGTCGACAGAAACTTACAAACTATTTACAAATCGTCTAAACTGCCCGGAAATATGTCGATGCCAGAAAAAGTTCGAACCAACTTAGGAAAGTTACGTGATATAGTAATATTTGATGTCAACAACCAACCGACCGATGAGAGCAATCCCTGCAGAAAGTTTGGAAATGGTGGCTGCGAACAACTATGCTTCAGCTTCCCGCCAGACAACGGCGTCACAATGCGATGTGACTGTGCCACGGGACAGGTATCAGCCACAAATCCGACTAAATGTGATGTTGTAGATGAATACCTAGTCTTTACGACTAGAACGGAAATTCGAGCTGTCAACCTTGATCCGAAGTCTACCGGCGTACCGTTCAAACCCGTAGTCAATTTGACCAACGTCGTCGGAGTCGAGTTCGACTACGCTGACAACAAATTATTTTTTACACAAATCAGACCGTGGGCGAGAATCGGTTGGATGTCTGCTAATAATCCAAGTTCTGCTGCCATCCAGAATATTATAAACAAAGGTATCAATCCTGAAGGCATCTCGTATGATTGGACTCAGCGGAAAGTTTACTGGACCGACAGCTCTAATAACTCCATCTATGCCATGAACTTGGATGGTTCCGAACTAGTTATGATAGCCCGAGTTGAAAGACCTAGAGCCATCGTGGTCGACCCATGTAATGGCACGTTATATTACACGGATTGGGGAAGATTTGGAACTTCAGGTAAAATATACCGAACGACAATGGCAGGCTCATTGAAGAAAGCTATTATCGACAAAGATTTATCACAACCCAGCGGCTTAACTATCGACTTCGATGAAAACATATTGTATTGGACTGATGCAGTACGAGAAAAAATTGAAAGATCGAAACTTGACGGCAGCGACAGAGAAGTACTAATCTCGGCAACGATCTATCCATTCGCCATTACCGTCTTCGGTAATTATATTTACTGGACCGACCTTCAACTGCGAGGAGTTTATCGTGCCGAGAAACATACGGGAGCCAATATGATCGAGATGGTAAAACGACTAGAGGACTCCCCACGAGACATTCACGTCTACAGCCCGAAAAGACAGAAGTGTCAAGTGAATCTTTGCAAGATCAGCAACGGAGGTTGCGCCCATAGTTGTCATCCAGCACCCAATAATACGGTCGAATGCAGATGTGACGAAAACACAAAATTAGTGAATGAAGGTCGCATGTGCGTGGCTAAGAACATCACCTGTGACTCGTACAAATTTTTCTGTGGTAACGGAAAGTGCATCAGTAGGATGTGGTCTTGCGACGGGGATGATGACTGCGGTGACAACTCTGACGAAGATAAGAACTACTGCGCATACCATTCTTGTTCACCAAATGAGTTCCGCTGTAATAACGGACGTTGCATATTTAAATCTTGGAAATGCGATCACGAAAATGACTGTAAGGACGGCTCTGACGAAGAAGGTTGCGTCTTCCCGCCGTGCGCTGATGGCGAATTTACTTGCCTCAATTCTCGCTGTATTCCCATGTCACAAGTCTGTAACGGCATCAACGACTGCAAGGATAATGTGACCAGCGACGAGACGCAAGAGCGCTGTCCTACGAACACAACATGTCCCACTAACCACTTGAAGTGCGAGAAGACAAACATCTGCGTCGAACCGTACTGGCTGTGTGATGGAGACAATGACTGCGGTGACAACTCTGACGAGGATCCACTCCACTGCGCGCAAAGAACTTGTCCGTCCAACAGCTTCCGCTGTCCGAACCATCGGTGCATCCCTGCTACTTGGTACTGCGACGGTGATGACGATTGTGGTGACGGTGCCGATGAACCACCCGAGTACTGCCGCTCGGAAGGCCGGACCTGCTTCGGGGACCTTTTCACCTGTGACAATGGAAACTGCATTCCCCGGATCTACATCTGTGACGGTGACAACGATTGCCTTGACAACAGTGACGAAGACGACCGCCATCAGTGCAACGAACGTAAGTGCGATGCGGAAACCGAGTACACCTGCGAAGAGAACAAGGCCTGGGGAAGGGCGCAGTGTATACCCAAGAAGTGGCTGTGTGATGGTGATCCGGACTGTATTGATGGCGCTGATGAAAACTCTACCATCCACCACTGCTCCACTCCAACGCCGTGCACCGACGATCAATTCCAGTGCAACAACGGCCGCTGTATCAACCGAGGCTGGGTCTGCGATCACGACAATGACTGCGGAGATGGCTCCGATGAAGGAAAACATTGCAATACGCAATACAAACAGTGTACGGACCAGGAATTCAAGTGTCAAAATTTTAAATGCGTTAGGAACCACTTCAGATGCGATGGCGAAGACGACTGCGGTGATCACTCAGACGAGGTCGGCTGCGTCAAACAAAATAAAACGTGTCCGACAGGACAGTTCAAGTGTAACAACGACCAGTGCATCGATTACAGCCTCGTTTGCAATAAGGTGTCAGACTGCAGCGATGACTCCGACGAGCCGGCCCACTGCAACGTCGACGAGTGTGCTAAGCTGGAGATTAACCAGTGCGGGCATAAGTGCATCGACACTCTCACCAGCTACTACTGCGACTGCAACCAGGGCTACAAACTCCTCACTGACGGCAAAGCATGTGCAGATATCGACGAGTGTATAGAGACTCCAGGCGTCTGCTCCCAGTACTGCTCTAACACTCCTGGCTCTTATTATTGCAAGTGTAATGATCAATACTATGAGAGAGAGGCTGACGAACACACCTGCAAGAGAAGAGATAAGATACCGCCATGGGTCATATTCACAAATAAGTACTACGTGAGAAACATGTCTACGGACGCATCTCTGTACAATCTGGTTCATCAGGACCTAATGAACGTTGTCGCCATAGACTTCGATATAAAAGAAGAACAGATGTACTTTGCTGACGTTTCCGCCAAGACCATATACAGATCTAACTACACCGACCCCAATCCCACAAAGGAAGTCGTGATTAGGCATGACTCTCATGGACTGGAAGGTATCGCGGTTGATTGGATCGGAAGAAAGTTGTACTGGCTTGACAGACACTCTAAGAACTTGGACGTCTCCGAATTAGACGGAACGAGACGGAAGACGCTTAAAACCGGAATCGCCGATCCCAGAGCTATAGTTGTCCATCCAGGAACTGGCTATCTATACTTTACGTCTTGGCATCTGCAAGCGTACATTGGAAAGATGGGCATGGACGGATCAAACTTCACTATGATTTTGAACTGGGACGACGACATCGCCTGGCCTAATGCGCTGACCATCGATTACTTCACAGACAGGATTTATTGGGCCGACGCTCACTTGGACTATATCGGGTCAGCCGATTTAGAGGGTAGACACAGACACGTGGTGCTCTCTGGAAAGTCCGTACCTCATGTTTTTGCTCTCAGCTTGTTCGATGACGATATTTATTGGACTGACTGGAATTTGAAAGCTATAAGAAAAGCTAACAAGCATTCCGGCGAGAACTTGACGGTTTTAAGAAATACCACCCACAGACCATACGATATCCACGTAGTGCACCCTCTGCGACAACTGCCTTATCCTAATCCTTGCGGCGATAACAATGGAGGCTGCTCTCATCTCTGTCTGATCGCTCCTCCGCACGAGTCGAGTTATCTAAATATTGAAGGTTATGGCGAGGAAGGTGCCACCACATACAAATGCGACTGTCCGAATCAGTTCTACTTAGCTAGAGACATGAAGACTTGCATAGTCAATTGCACCGATGGACAACACAGGTGTAACGGTCGCGACGAAAAATGTATCCCATGGTTCTGGAAATGTGATGGAGAAAAAGATTGCAAAGACGGTTCCGACGAACCCGACACCTGCCCGGTGAGACACTGCAGAGCTGGCTCCTTCCAGTGCAAGAATACTAACTGTACCCCTGCGGCCACTATTTGTGACGGGACGGACGACTGCGGTGACGGCAGCGACGAAGCAGAATGCGCACACAATTACACCGACTGCAAGGATAACAGTGACGAGGACCCGGCGATGTGTCACAATAGAACTTGTAATCCCGACACTGAATTTTCGTGCAAGAATGGTCGCTGCATTCCGAAACTGTGGATGTGCGACTTCGATAACGACTGCGGCGACGACTCCGATGAGCCCGCCTACATGTGCCGACAGAAGAACTGCACCACCGGATGGCGCCGGTGTCCCGGACAGTCCAACTACAGGTGTATTCCTAAGTGGTTGTTCTGCGATGGAAAAGACGATTGCAGAGATGGTTCAGACGAACTAGCCGAAAACTGTCCAACTTGCGCTGCCGAGACTGACTTTACGTGCGACAACAAAAGATGCATACCGAAACAATGGCTCTGTGACTTTACCGACGACTGCGGCGACGGCAGCGATGAAACCGAAGCTCTCTGTCAGAGCAAATACAGAGAGTGCTCCGAGTCCGAGTTCAAGTGTGGCAGTGGCAAGTGCATATCCTCGAGATGGAGATGCGACCACGAGGACGACTGCGGCGATAACTCGGACGAGACGGACTGCGGGGGCTTCCAGTGCAAGAACGGAACGTTCCAGTGCCGCTCCGGCCATTGCATCGCGGCGCACTTCCGCTGCGACGGCGACCGAGACTGTCGGGACCTCTCCGACGAGATTGGCTGTCCACCTAAGTTTCCCGGCGGCAGATATTGTCCCGAAAATAAATTCCAATGCGGCAATACCCTGTGCGTGTCGCAGTCGGACCTGTGCGACGGCACGGACGACTGCGGGGACGGCTCGGACGAGACGCCCGACATCTGCAACAACTTCAACTGCGACACCCTTCGCCGCTTCCACTGCGACAACCACCGCTGCGTACCCAGGTACCAGGTGTGCGACGGCGTGGACAACTGCGGCGACGGCTCGGACGAGAACAACATGACGCTGTGCGCCAGCCGCGCGCGCCCCTGCGAGCCGCTCACGCAGTTCCAGTGCGCCAACAAGCAGTGCGTGGAGCGGCGCCGCCTGTGCGACCTGGGCGACGACTGCGGGGACGGCTCCGACGAGCTGGGCTGCCATCACGAGCGCTCCTGCTCACATCTAGATAAAGGTGGGTGCGAGCAGTTCTGCACGAACTTGACGTCCAGCAACGGCGGGTACATCTGTACGTGCTTCCAGGGCTGGATCATTTCGTCCGCCGACCCCAAGCGCTGCGTGGATCTGGACGAGTGCTCTGCTGGCCTCCACCACTGCTCCCATCTCTGTACCAACCTCAACGGAAGTTTTAGCTGTTCTTGTCGAGAAGGGTTCCAACTCGCCGACAGTCTGTCTGGAGTGTGCAAGGCGACGAAGGATGACGTCGTCCTGTTATACTCGAACGGCCCAGAGATCCGAGCCTTTGCACAGAGCAAGAATGAGCAGTTCGACGTGATCACCTCCGAGAAGAGGATCGAAGCCATCGACTACGACCCGGTTAACGAAATGATATTTTGGGCGGACAGCTACGACAAGACGATCAAGCGATCCTACATGGTGAACGCGATGAACGGCGCCGTCAAAATTGGATTCGCGCAGGATTTGAACATGAAGGGTAACTCTAAGCCGACCGCCCTCGCCGTGGACTACGTGGGAGACAACCTCTACTGGACGGAGGTGGAGCGACTCGGGTCCAAGCCCCGAGGTCGCGTGCTGGTGGCGCGGACGGACGGGCGGTACCGCCGCGTGCTGGTGGCCGCAGGGCTGGAGTCCCCCACGGCGCTGGCGCTCGACGCGAGAGCCGGACGCATCCTGTGGGCAGACGCCGGTACCGCACCCAAAATAGAGATCGCCTGGATGGACGGCTCCAAGCGGCGGCCGCTCGTCACCGAGAACATCCGCCATCCCACAGGCCTCGTCATCGACCACGCCATGGATCGCGCTGTCTACTGGGCAGACACTAAGCTGAACACTATTGAGATGATGCGTCACGACGGCTCCCAGCGTCGGGTCATCCTCAAGGGAGATCTGCTGCGGCATCCGCTATCACTGGACGTGTTCGAGTCCTCGTTGTATTGGGTCACCAGGGACACCGGGGAGCTGCTGCGACAGGATAAGTTTGGTCGAGGCGTCGCTTTTGTTATATCTCGAGATCTCGTGAACCCGTCTGGAGTCAAAGTATACCACCCCCTCCGGTACAACGTGTCGGCGCTGACGGCGTGCTCGCGCGCGGCGTGCTCGCACCTGTGCCTCGTGGTGCCGGGCGGGCGCCGCTGCACGTGCCCCGACCAGCAGCCGCCGCCCAAGCGGGCCACGCAGGAGCTGGCCTGCGACGCACCGATAGAAGTCCCCCGTCCTTTACCCCGCATCTGCGAGTGCGAGAACGGTGGAACGTGCGTGGAGCGCGCCGACGGAGGCCTGGAGTGCCGCTGCGGAGAGGCGGGGGCGGGCCCGCAGTGCGCGTCCCCCGCCGCCGTGCGGGCCGGCGCAGGGACCGGCGCGGCCGTGCTGGTGCCGGTGCTGCTGGTGCTGCTGCTCGGAGTTGCTGCCGGAGCCGCCTGGTTCGTCATCAGGAAAAGGCCGTTTGGTAAAGGCGGCCTGAGCAGTCTAGCGTCATCCCAGAGCGTCTCGTTCCGTCAGGGCTCCAACGTGGAGTTCGGTGGCGTATCAGAACCCGCCTACACGCTCGAGGAAACAGCGGCTGCAGCAGCCGCCGCCGCGGCCGCTAGAAAGGGGAGAGATTTCTCCAACCCTATGTATGATGCGGTCACGCGGGCTGTTGCCGCGGGTGAGCCTGAACCGCCGTTACCTGGCATTTACGAAGTACCAGACGAGTTAAAAGATAAGGTAGCATCCGCTGTGATCTCCCCTTCATCAAGTGAGACGCGTCATGCCGCAGCGTTAGGCGCCGGCGCGGTGCGGGCTCTGGAGCCAGCCGCTGACACCGGCGCCGACACGCAGGGCCTTGTGCGCGAGGACAAGCATTGCTAG

Protein

MFRCPEGKCIPSLWVCNYQKDCDKGEDEFQSCPPPECDAGQLSCNQYVWNKTYCIPPHYRCDMHVDCVDGSDEADCTYRKCQADDFQCGMEGTGKVSSQGPCVTKEKKCDGYLDCRTGKDEQDCPGQSIACRLDQFRCASGNKCVDASAKCDHKDDCGDNSDEAHCSFPPCHIGQFRCSNALCIPANYHCDGYNDCADGSDEANCTAIACPDNQYLCPKGGPGGVHKCIARSQLCDGKKDCEDKADEEDACSILSCPALGCEYKCVASLAGGACSCAAGLMLSADNRTCVDRDECKEWGYCHQLCVNTLGSYKCQCAPGYSLVDGKRCSAGVAASPWLVLAHAGAVLRMDLHGRAPQTLANATAAAGLDYHYRRNLLFWSDLKTRKIHSQQLSAPAGLGRFGDAEISVAGSWAPVALAVDWVGDKLYVADSLGQKVDVFELDGRWHAVVLGSNLTSPADLALDPTLGLMFVADSSQIIRANMDGTHMKAIVSEAAYKASGIAVDIIARRVFWCDSLLDYIETVDYDGNHRFLVLRGQQVPSPSRLALFEDRVYWSDSTKQGISSVNKYGGASSIQAIYKMKDIRDPKAITVIHSLKQTSVNNPCGTNNGGCSQMCIVTALQNGGLGYRCACNIGYRLETDLRNCDIVNEFLMYSQQRFIKGKVLNPVIEGFSDAILPVVSRRARFVGLDFDARDEHIYYSDVLQDVIYRVHRNGTTREIVLASQNEGVEGLAVDWASKNLYYIDSRKGTLNVLSTRNIAYKRTLLKDLKRPRAIVVHPNKGFIFFSEWDRPANISRSNTDGTGLLVFENVTLGWPNGLSIDFDTDRLYWCDALLDHVQHSKLDGTDVKTVSSRLIRHPFSIVIHKEFMYITDWRLDAIVRLHKLTGEQEDIMVREPQTNRLYGVKVYSEKIQKIDPMQPCARNNGNCQKLCFAIPRNNTEFLTVKCGCPYGEKLAADGQTCESDPNSEPPVQACPQSWDFTCNNQRCIPKSWVCDGDDDCLDNSDEEQNCTKATCGPREFMCKSGRCISDMFRCDSENDCGDFSDETGCVNVTCSSAQFQCDNGRCVPSTWKCDSENDCGDGSDEGPHCAEKTCAYFQYTCPRTGHCIPASWVCDGDDDCFDKQDEADCPPVSCLPNQFKCADLKQCVLEVYKCDGIPDCNDGSDELGCPSLAPHQCQPGKQFQCRSSGICIPSTWHCDGTPDCEDLSDEPASCGTVECAPNYFRCDNGRCIFKTYVCDGNDDCQDGSDEGLQHACKAPPFRCPSDQWECPQASGRCINFTQVCDDKLDCPGGTDEGPVCSEKQCSWRGAQCSHGCHETPGGAQCVCPRGLQLTPGEPDAATCSDLNECEPPGVCSQLCTNTKGSYACGCVAGYRLALDAHSCKADNHSGAFLIISNRHSILVADLDEQGLERVPIDVENVVATASDMHTGTIFWSDMKLKKISRLDRGGEPKVIVSTGLDLVEGLAYDWVGGNVYWLDSKLNTIEVAKEDGAARTTLLSGNITQPRGMCLDPAPDARWLFWTDWGEHPRVERIGMDGTRRMAIITTKIYWPNGLTLDTATKRVYFADSKLDFIDFCNYDGTGRQQVLSGSHYLLHPHSLTLFEDTLYWTDRQLNRVLSAHKFKGSNQTVVSHLISQPLSIHVHHPSLQQQYTSPCKRDTCQHLCLLSPNQTVGYTCMCQPGYKLLQDGKCADEETAYLMVLKGTQVIDLSTDGSGRAGQLSPVVGIQGGIQLDYDRQGHTLYWLQSISGDSEDDENCTIYTMPYGGGNKAEFLGRDTGIVGAPSSIAFDWIGRNLYIANRVASNIELIKVDGKVKYRTIVMANDGGKMSVAKPRALALDPTEGKMYWSDEGGYGVPPKIGKANMDGTNSIILVDTIERPEAITIDIERKIVYFSTQYPATVISVNTDGNDRKTILDESNGISYPKVIAVLDLRLYILDPRHEKIIQADLPNGDNIKTIIDNESDLKSFTIFQKRKMIHHPCSQSNGGCEQICIPGDDSVSRVCACSIGYRKENEIHCVPYKTFAVVSQLDLIRGYSLDTSAEAMVPITGSGHHILHVDVHFAENYIYWVEFNRGQWNGVFRIRPNGTELQHIIKDGIGSNGIRGLAVDWVAGNLYFTNVFPHESYVEMCWLDGSNRKVLVKTTMDAPRELAVNPIYRFLYWIDYGQYPRIGRAYLDGSQWNTLVSSGISNPRDLTIDMLTHDVYWVDSKLDQIQKISYSGGNRQVIRSNLPNPMGIAVHTGSVYWVDRNLQTIYKSSKLPGNMSMPEKVRTNLGKLRDIVIFDVNNQPTDESNPCRKFGNGGCEQLCFSFPPDNGVTMRCDCATGQVSATNPTKCDVVDEYLVFTTRTEIRAVNLDPKSTGVPFKPVVNLTNVVGVEFDYADNKLFFTQIRPWARIGWMSANNPSSAAIQNIINKGINPEGISYDWTQRKVYWTDSSNNSIYAMNLDGSELVMIARVERPRAIVVDPCNGTLYYTDWGRFGTSGKIYRTTMAGSLKKAIIDKDLSQPSGLTIDFDENILYWTDAVREKIERSKLDGSDREVLISATIYPFAITVFGNYIYWTDLQLRGVYRAEKHTGANMIEMVKRLEDSPRDIHVYSPKRQKCQVNLCKISNGGCAHSCHPAPNNTVECRCDENTKLVNEGRMCVAKNITCDSYKFFCGNGKCISRMWSCDGDDDCGDNSDEDKNYCAYHSCSPNEFRCNNGRCIFKSWKCDHENDCKDGSDEEGCVFPPCADGEFTCLNSRCIPMSQVCNGINDCKDNVTSDETQERCPTNTTCPTNHLKCEKTNICVEPYWLCDGDNDCGDNSDEDPLHCAQRTCPSNSFRCPNHRCIPATWYCDGDDDCGDGADEPPEYCRSEGRTCFGDLFTCDNGNCIPRIYICDGDNDCLDNSDEDDRHQCNERKCDAETEYTCEENKAWGRAQCIPKKWLCDGDPDCIDGADENSTIHHCSTPTPCTDDQFQCNNGRCINRGWVCDHDNDCGDGSDEGKHCNTQYKQCTDQEFKCQNFKCVRNHFRCDGEDDCGDHSDEVGCVKQNKTCPTGQFKCNNDQCIDYSLVCNKVSDCSDDSDEPAHCNVDECAKLEINQCGHKCIDTLTSYYCDCNQGYKLLTDGKACADIDECIETPGVCSQYCSNTPGSYYCKCNDQYYEREADEHTCKRRDKIPPWVIFTNKYYVRNMSTDASLYNLVHQDLMNVVAIDFDIKEEQMYFADVSAKTIYRSNYTDPNPTKEVVIRHDSHGLEGIAVDWIGRKLYWLDRHSKNLDVSELDGTRRKTLKTGIADPRAIVVHPGTGYLYFTSWHLQAYIGKMGMDGSNFTMILNWDDDIAWPNALTIDYFTDRIYWADAHLDYIGSADLEGRHRHVVLSGKSVPHVFALSLFDDDIYWTDWNLKAIRKANKHSGENLTVLRNTTHRPYDIHVVHPLRQLPYPNPCGDNNGGCSHLCLIAPPHESSYLNIEGYGEEGATTYKCDCPNQFYLARDMKTCIVNCTDGQHRCNGRDEKCIPWFWKCDGEKDCKDGSDEPDTCPVRHCRAGSFQCKNTNCTPAATICDGTDDCGDGSDEAECAHNYTDCKDNSDEDPAMCHNRTCNPDTEFSCKNGRCIPKLWMCDFDNDCGDDSDEPAYMCRQKNCTTGWRRCPGQSNYRCIPKWLFCDGKDDCRDGSDELAENCPTCAAETDFTCDNKRCIPKQWLCDFTDDCGDGSDETEALCQSKYRECSESEFKCGSGKCISSRWRCDHEDDCGDNSDETDCGGFQCKNGTFQCRSGHCIAAHFRCDGDRDCRDLSDEIGCPPKFPGGRYCPENKFQCGNTLCVSQSDLCDGTDDCGDGSDETPDICNNFNCDTLRRFHCDNHRCVPRYQVCDGVDNCGDGSDENNMTLCASRARPCEPLTQFQCANKQCVERRRLCDLGDDCGDGSDELGCHHERSCSHLDKGGCEQFCTNLTSSNGGYICTCFQGWIISSADPKRCVDLDECSAGLHHCSHLCTNLNGSFSCSCREGFQLADSLSGVCKATKDDVVLLYSNGPEIRAFAQSKNEQFDVITSEKRIEAIDYDPVNEMIFWADSYDKTIKRSYMVNAMNGAVKIGFAQDLNMKGNSKPTALAVDYVGDNLYWTEVERLGSKPRGRVLVARTDGRYRRVLVAAGLESPTALALDARAGRILWADAGTAPKIEIAWMDGSKRRPLVTENIRHPTGLVIDHAMDRAVYWADTKLNTIEMMRHDGSQRRVILKGDLLRHPLSLDVFESSLYWVTRDTGELLRQDKFGRGVAFVISRDLVNPSGVKVYHPLRYNVSALTACSRAACSHLCLVVPGGRRCTCPDQQPPPKRATQELACDAPIEVPRPLPRICECENGGTCVERADGGLECRCGEAGAGPQCASPAAVRAGAGTGAAVLVPVLLVLLLGVAAGAAWFVIRKRPFGKGGLSSLASSQSVSFRQGSNVEFGGVSEPAYTLEETAAAAAAAAAARKGRDFSNPMYDAVTRAVAAGEPEPPLPGIYEVPDELKDKVASAVISPSSSETRHAAALGAGAVRALEPAADTGADTQGLVREDKHC

Description

Multiligand endocytic receptor. Acts together with CUBN to mediate endocytosis of high-density lipoproteins (By similarity). Mediates receptor-mediated uptake of polybasic drugs such as aprotinin, aminoglycosides and polymyxin B (PubMed:7544804, PubMed:19202329). In the kidney, mediates the tubular uptake and clearance of leptin (By similarity). Also mediates transport of leptin across the blood-brain barrier through endocytosis at the choroid plexus epithelium (PubMed:17324488). Endocytosis of leptin in neuronal cells is required for hypothalamic leptin signaling and leptin-mediated regulation of feeding and body weight (By similarity). Mediates endocytosis and subsequent lysosomal degradation of CST3 in kidney proximal tubule cells (PubMed:17462596). Mediates renal uptake of 25-hydroxyvitamin D3 in complex with the vitamin D3 transporter GC/DBP (By similarity). Mediates renal uptake of metallothionein-bound heavy metals (PubMed:15126248). Together with CUBN, mediates renal reabsorption of myoglobin (PubMed:12724130). Mediates renal uptake and subsequent lysosomal degradation of APOM (PubMed:16099815). Plays a role in kidney selenium homeostasis by mediating renal endocytosis of selenoprotein SEPP1 (By similarity). Mediates renal uptake of the antiapoptotic protein BIRC5/survivin which may be important for functional integrity of the kidney (By similarity). Mediates renal uptake of matrix metalloproteinase MMP2 in complex with metalloproteinase inhibitor TIMP1 (PubMed:28659595). Mediates endocytosis of Sonic hedgehog protein N-product (ShhN), the active product of SHH (PubMed:11964399, PubMed:16801528). Also mediates ShhN transcytosis (PubMed:16801528). In the embryonic neuroepithelium, mediates endocytic uptake and degradation of BMP4, is required for correct SHH localization in the ventral neural tube and plays a role in patterning of the ventral telencephalon (By similarity). Required at the onset of neurulation to sequester SHH on the apical surface of neuroepithelial cells of the rostral diencephalon ventral midline and to control PTCH1-dependent uptake and intracellular trafficking of SHH (By similarity). During neurulation, required in neuroepithelial cells for uptake of folate bound to the folate receptor FOLR1 which is necessary for neural tube closure (By similarity). In the adult brain, negatively regulates BMP signaling in the subependymal zone which enables neurogenesis to proceed (By similarity). In astrocytes, mediates endocytosis of ALB which is required for the synthesis of the neurotrophic factor oleic acid (PubMed:18466341). Involved in neurite branching (By similarity). During optic nerve development, required for SHH-mediated migration and proliferation of oligodendrocyte precursor cells (By similarity). Mediates endocytic uptake and clearance of SHH in the retinal margin which protects retinal progenitor cells from mitogenic stimuli and keeps them quiescent (By similarity). Plays a role in reproductive organ development by mediating uptake in reproductive tissues of androgen and estrogen bound to the sex hormone binding protein SHBG (PubMed:16143106). Mediates endocytosis of angiotensin-2 (PubMed:15467006). Also mediates endocytosis of angiotensin 1-7 (PubMed:16380466). Binds to the complex composed of beta-amyloid protein 40 and CLU/APOJ and mediates its endocytosis and lysosomal degradation (By similarity). Required for embryonic heart development (By similarity). Required for normal hearing, possibly through interaction with estrogen in the inner ear (PubMed:17846082).
Multiligand endocytic receptor. Acts together with CUBN to mediate endocytosis of high-density lipoproteins (PubMed:10766831). Mediates receptor-mediated uptake of polybasic drugs such as aprotinin, aminoglycosides and polymyxin B (By similarity). In the kidney, mediates the tubular uptake and clearance of leptin (PubMed:22841573). Also mediates transport of leptin across the blood-brain barrier through endocytosis at the choroid plexus epithelium (By similarity). Endocytosis of leptin in neuronal cells is required for hypothalamic leptin signaling and leptin-mediated regulation of feeding and body weight (PubMed:24825475). Mediates endocytosis and subsequent lysosomal degradation of CST3 in kidney proximal tubule cells (PubMed:17462596). Mediates renal uptake of 25-hydroxyvitamin D3 in complex with the vitamin D3 transporter GC/DBP (PubMed:10052453). Mediates renal uptake of metallothionein-bound heavy metals (By similarity). Together with CUBN, mediates renal reabsorption of myoglobin (By similarity). Mediates renal uptake and subsequent lysosomal degradation of APOM (By similarity). Plays a role in kidney selenium homeostasis by mediating renal endocytosis of selenoprotein SEPP1 (PubMed:18174160). Mediates renal uptake of the antiapoptotic protein BIRC5/survivin which may be important for functional integrity of the kidney (PubMed:23825075). Mediates renal uptake of matrix metalloproteinase MMP2 in complex with metalloproteinase inhibitor TIMP1 (PubMed:28659595). Mediates endocytosis of Sonic hedgehog protein N-product (ShhN), the active product of SHH (By similarity). Also mediates ShhN transcytosis (By similarity). In the embryonic neuroepithelium, mediates endocytic uptake and degradation of BMP4, is required for correct SHH localization in the ventral neural tube and plays a role in patterning of the ventral telencephalon (PubMed:15623804). Required at the onset of neurulation to sequester SHH on the apical surface of neuroepithelial cells of the rostral diencephalon ventral midline and to control PTCH1-dependent uptake and intracellular trafficking of SHH (PubMed:22340494). During neurulation, required in neuroepithelial cells for uptake of folate bound to the folate receptor FOLR1 which is necessary for neural tube closure (PubMed:24639464). In the adult brain, negatively regulates BMP signaling in the subependymal zone which enables neurogenesis to proceed (PubMed:20460439). In astrocytes, mediates endocytosis of ALB which is required for the synthesis of the neurotrophic factor oleic acid (By similarity). Involved in neurite branching (PubMed:20637285). During optic nerve development, required for SHH-mediated migration and proliferation of oligodendrocyte precursor cells (PubMed:22354480). Mediates endocytic uptake and clearance of SHH in the retinal margin which protects retinal progenitor cells from mitogenic stimuli and keeps them quiescent (PubMed:26439398). Plays a role in reproductive organ development by mediating uptake in reproductive tissues of androgen and estrogen bound to the sex hormone binding protein SHBG (PubMed:16143106). Mediates endocytosis of angiotensin-2 (By similarity). Also mediates endocytosis of angiotensin 1-7 (By similarity). Binds to the complex composed of beta-amyloid protein 40 and CLU/APOJ and mediates its endocytosis and lysosomal degradation (By similarity). Required for embryonic heart development (PubMed:26822476). Required for normal hearing, possibly through interaction with estrogen in the inner ear (PubMed:17846082).
Multiligand endocytic receptor (By similarity). Acts together with CUBN to mediate endocytosis of high-density lipoproteins (By similarity). Mediates receptor-mediated uptake of polybasic drugs such as aprotinin, aminoglycosides and polymyxin B (By similarity). In the kidney, mediates the tubular uptake and clearance of leptin (By similarity). Also mediates transport of leptin across the blood-brain barrier through endocytosis at the choroid plexus epithelium (By similarity). Endocytosis of leptin in neuronal cells is required for hypothalamic leptin signaling and leptin-mediated regulation of feeding and body weight (By similarity). Mediates endocytosis and subsequent lysosomal degradation of CST3 in kidney proximal tubule cells (By similarity). Mediates renal uptake of 25-hydroxyvitamin D3 in complex with the vitamin D3 transporter GC/DBP (By similarity). Mediates renal uptake of metallothionein-bound heavy metals (PubMed:15126248). Together with CUBN, mediates renal reabsorption of myoglobin (By similarity). Mediates renal uptake and subsequent lysosomal degradation of APOM (By similarity). Plays a role in kidney selenium homeostasis by mediating renal endocytosis of selenoprotein SEPP1 (By similarity). Mediates renal uptake of the antiapoptotic protein BIRC5/survivin which may be important for functional integrity of the kidney (PubMed:23825075). Mediates renal uptake of matrix metalloproteinase MMP2 in complex with metalloproteinase inhibitor TIMP1 (By similarity). Mediates endocytosis of Sonic hedgehog protein N-product (ShhN), the active product of SHH (By similarity). Also mediates ShhN transcytosis (By similarity). In the embryonic neuroepithelium, mediates endocytic uptake and degradation of BMP4, is required for correct SHH localization in the ventral neural tube and plays a role in patterning of the ventral telencephalon (By similarity). Required at the onset of neurulation to sequester SHH on the apical surface of neuroepithelial cells of the rostral diencephalon ventral midline and to control PTCH1-dependent uptake and intracellular trafficking of SHH (By similarity). During neurulation, required in neuroepithelial cells for uptake of folate bound to the folate receptor FOLR1 which is necessary for neural tube closure (By similarity). In the adult brain, negatively regulates BMP signaling in the subependymal zone which enables neurogenesis to proceed (By similarity). In astrocytes, mediates endocytosis of ALB which is required for the synthesis of the neurotrophic factor oleic acid (By similarity). Involved in neurite branching (By similarity). During optic nerve development, required for SHH-mediated migration and proliferation of oligodendrocyte precursor cells (By similarity). Mediates endocytic uptake and clearance of SHH in the retinal margin which protects retinal progenitor cells from mitogenic stimuli and keeps them quiescent (By similarity). Plays a role in reproductive organ development by mediating uptake in reproductive tissues of androgen and estrogen bound to the sex hormone binding protein SHBG (By similarity). Mediates endocytosis of angiotensin-2 (By similarity). Also mediates endocytosis of angiotensis 1-7 (By similarity). Binds to the complex composed of beta-amyloid protein 40 and CLU/APOJ and mediates its endocytosis and lysosomal degradation (By similarity). Required for embryonic heart development (By similarity). Required for normal hearing, possibly through interaction with estrogen in the inner ear (By similarity).
Multiligand endocytic receptor (By similarity). Acts together with CUBN to mediate endocytosis of high-density lipoproteins (By similarity). Mediates receptor-mediated uptake of polybasic drugs such as aprotinin, aminoglycosides and polymyxin B (By similarity). In the kidney, mediates the tubular uptake and clearance of leptin (By similarity). Also mediates transport of leptin across the blood-brain barrier through endocytosis at the choroid plexus epithelium (By similarity). Endocytosis of leptin in neuronal cells is required for hypothalamic leptin signaling and leptin-mediated regulation of feeding and body weight (By similarity). Mediates endocytosis and subsequent lysosomal degradation of CST3 in kidney proximal tubule cells (By similarity). Mediates renal uptake of 25-hydroxyvitamin D3 in complex with the vitamin D3 transporter GC/DBP (By similarity). Mediates renal uptake of metallothionein-bound heavy metals (By similarity). Together with CUBN, mediates renal reabsorption of myoglobin (By similarity). Mediates renal uptake and subsequent lysosomal degradation of APOM (By similarity). Plays a role in kidney selenium homeostasis by mediating renal endocytosis of selenoprotein SEPP1 (By similarity). Mediates renal uptake of the antiapoptotic protein BIRC5/survivin which may be important for functional integrity of the kidney (By similarity). Mediates renal uptake of matrix metalloproteinase MMP2 in complex with metalloproteinase inhibitor TIMP1 (By similarity). Mediates endocytosis of Sonic hedgehog protein N-product (ShhN), the active product of SHH (By similarity). Also mediates ShhN transcytosis (By similarity). In the embryonic neuroepithelium, mediates endocytic uptake and degradation of BMP4, is required for correct SHH localization in the ventral neural tube and plays a role in patterning of the ventral telencephalon (By similarity). Required at the onset of neurulation to sequester SHH on the apical surface of neuroepithelial cells of the rostral diencephalon ventral midline and to control PTCH1-dependent uptake and intracellular trafficking of SHH (By similarity). During neurulation, required in neuroepithelial cells for uptake of folate bound to the folate receptor FOLR1 which is necessary for neural tube closure (By similarity). In the adult brain, negatively regulates BMP signaling in the subependymal zone which enables neurogenesis to proceed (By similarity). In astrocytes, mediates endocytosis of ALB which is required for the synthesis of the neurotrophic factor oleic acid (By similarity). Involved in neurite branching (By similarity). During optic nerve development, required for SHH-mediated migration and proliferation of oligodendrocyte precursor cells (By similarity). Mediates endocytic uptake and clearance of SHH in the retinal margin which protects retinal progenitor cells from mitogenic stimuli and keeps them quiescent (By similarity). Plays a role in reproductive organ development by mediating uptake in reproductive tissues of androgen and estrogen bound to the sex hormone binding protein SHBG (By similarity). Mediates endocytosis of angiotensin-2 (By similarity). Also mediates endocytosis of angiotensis 1-7 (By similarity). Binds to the complex composed of beta-amyloid protein 40 and CLU/APOJ and mediates its endocytosis and lysosomal degradation (PubMed:9228033). Required for embryonic heart development (By similarity). Required for normal hearing, possibly through interaction with estrogen in the inner ear (By similarity).
Endocytic receptor involved in endocytosis and in phagocytosis of apoptotic cells. Required for early embryonic development (PubMed:1423604). Involved in cellular lipid homeostasis. Involved in the plasma clearance of chylomicron remnants and activated LRPAP1 (alpha 2-macroglobulin), as well as the local metabolism of complexes between plasminogen activators and their endogenous inhibitors. May modulate cellular events, such as APP metabolism, kinase-dependent intracellular signaling, neuronal calcium signaling as well as neurotransmission. Acts as an alpha-2-macroglobulin receptor (By similarity).
(Microbial infection) Functions as a receptor for Vibrio cholerae cholix toxin and for Pseudomonas aeruginosa exotoxin A.
Endocytic receptor involved in endocytosis and in phagocytosis of apoptotic cells. Required for early embryonic development. Involved in cellular lipid homeostasis. Involved in the plasma clearance of chylomicron remnants and activated LRPAP1 (alpha 2-macroglobulin), as well as the local metabolism of complexes between plasminogen activators and their endogenous inhibitors. May modulate cellular events, such as APP metabolism, kinase-dependent intracellular signaling, neuronal calcium signaling as well as neurotransmission (PubMed:11907044, PubMed:12888553, PubMed:12713657). Acts as an alpha-2-macroglobulin receptor (PubMed:26142438).
(Microbial infection) Functions as a receptor for Pseudomonas aeruginosa exotoxin A.
Endocytic receptor involved in endocytosis and in phagocytosis of apoptotic cells. Involved in cellular lipid homeostasis. Involved in the plasma clearance of chylomicron remnants and activated LRPAP1 (alpha 2-macroglobulin), as well as the local metabolism of complexes between plasminogen activators and their endogenous inhibitors. Acts as an alpha-2-macroglobulin receptor.
Mediates SOST-dependent inhibition of bone formation (By similarity). Functions as a specific facilitator of SOST-mediated inhibition of Wnt signaling (By similarity). Plays a key role in the formation and the maintenance of the neuromuscular junction (NMJ), the synapse between motor neuron and skeletal muscle. Directly binds AGRIN and recruits it to the MUSK signaling complex. Mediates the AGRIN-induced phosphorylation of MUSK, the kinase of the complex. The activation of MUSK in myotubes induces the formation of NMJ by regulating different processes including the transcription of specific genes and the clustering of AChR in the postsynaptic membrane. Alternatively, may be involved in the negative regulation of the canonical Wnt signaling pathway, being able to antagonize the LRP6-mediated activation of this pathway. More generally, has been proposed to function as a cell surface endocytic receptor binding and internalizing extracellular ligands for degradation by lysosomes. Plays an essential role in the process of digit differentiation.
Mediates SOST-dependent inhibition of bone formation. Functions as a specific facilitator of SOST-mediated inhibition of Wnt signaling. Plays a key role in the formation and the maintenance of the neuromuscular junction (NMJ), the synapse between motor neuron and skeletal muscle. Directly binds AGRIN and recruits it to the MUSK signaling complex. Mediates the AGRIN-induced phosphorylation of MUSK, the kinase of the complex. The activation of MUSK in myotubes induces the formation of NMJ by regulating different processes including the transcription of specific genes and the clustering of AChR in the postsynaptic membrane. Alternatively, may be involved in the negative regulation of the canonical Wnt signaling pathway, being able to antagonize the LRP6-mediated activation of this pathway. More generally, has been proposed to function as a cell surface endocytic receptor binding and internalizing extracellular ligands for degradation by lysosomes. May play an essential role in the process of digit differentiation (By similarity).
Mediates SOST-dependent inhibition of bone formation. Functions as a specific facilitator of SOST-mediated inhibition of Wnt signaling. Plays a key role in the formation and the maintenance of the neuromuscular junction (NMJ), the synapse between motor neuron and skeletal muscle. Directly binds AGRIN and recruits it to the MUSK signaling complex. Mediates the AGRIN-induced phosphorylation of MUSK, the kinase of the complex. The activation of MUSK in myotubes induces the formation of NMJ by regulating different processes including the transcription of specific genes and the clustering of AChR in the postsynaptic membrane. Alternatively, may be involved in the negative regulation of the canonical Wnt signaling pathway, being able to antagonize the LRP6-mediated activation of this pathway. More generally, has been proposed to function as a cell surface endocytic receptor binding and internalizing extracellular ligands for degradation by lysosomes. Plays an essential role in the process of digit differentiation (PubMed:16517118).
Component of the Wnt-Fzd-LRP5-LRP6 complex that triggers beta-catenin signaling through inducing aggregation of receptor-ligand complexes into ribosome-sized signalsomes. Cell-surface coreceptor of Wnt/beta-catenin signaling, which plays a pivotal role in bone formation. The Wnt-induced Fzd/LRP6 coreceptor complex recruits DVL1 polymers to the plasma membrane which, in turn, recruits the AXIN1/GSK3B-complex to the cell surface promoting the formation of signalsomes and inhibiting AXIN1/GSK3-mediated phosphorylation and destruction of beta-catenin. Required for posterior patterning of the epiblast during gastrulation (By similarity).
Acts as a coreceptor with members of the frizzled family of seven-transmembrane spanning receptors to transduce signal by Wnt proteins. Activates the canonical Wnt signaling pathway that controls cell fate determination and self-renewal during embryonic development and adult tissue regeneration (PubMed:11956231). In particular, may play an important role in the development of the posterior patterning of the epiblast during gastrulation (PubMed:15142971). During bone development, regulates osteoblast proliferation and differentiation thus determining bone mass (PubMed:11956231). Mechanistically, the formation of the signaling complex between Wnt ligand, frizzled receptor and LRP5 coreceptor promotes the recruitment of AXIN1 to LRP5, stabilizing beta-catenin/CTNNB1 and activating TCF/LEF-mediated transcriptional programs (By similarity). Acts as a coreceptor for non-Wnt proteins, such as norrin/NDP. Binding of norrin/NDP to frizzled 4/FZD4-LRP5 receptor complex triggers beta-catenin/CTNNB1-dependent signaling known to be required for retinal vascular development (By similarity). Plays a role in controlling postnatal vascular regression in retina via macrophage-induced endothelial cell apoptosis (PubMed:11956231).
Acts as a coreceptor with members of the frizzled family of seven-transmembrane spanning receptors to transduce signal by Wnt proteins (PubMed:11336703, PubMed:11448771, PubMed:15778503, PubMed:11719191, PubMed:15908424, PubMed:16252235). Activates the canonical Wnt signaling pathway that controls cell fate determination and self-renewal during embryonic development and adult tissue regeneration (PubMed:11336703, PubMed:11719191). In particular, may play an important role in the development of the posterior patterning of the epiblast during gastrulation (By similarity). During bone development, regulates osteoblast proliferation and differentiation thus determining bone mass (PubMed:11719191). Mechanistically, the formation of the signaling complex between Wnt ligand, frizzled receptor and LRP5 coreceptor promotes the recruitment of AXIN1 to LRP5, stabilizing beta-catenin/CTNNB1 and activating TCF/LEF-mediated transcriptional programs (PubMed:11336703, PubMed:25920554, PubMed:24706814, PubMed:14731402). Acts as a coreceptor for non-Wnt proteins, such as norrin/NDP. Binding of norrin/NDP to frizzled 4/FZD4-LRP5 receptor complex triggers beta-catenin/CTNNB1-dependent signaling known to be required for retinal vascular development (PubMed:27228167, PubMed:16252235). Plays a role in controlling postnatal vascular regression in retina via macrophage-induced endothelial cell apoptosis (By similarity).
Involved in uptake of vitellogenin by endocytosis. Expression is regulated by the juvenile hormone analog, methoprene (in vitro).
Binds VLDL and transports it into cells by endocytosis. In order to be internalized, the receptor-ligand complexes must first cluster into clathrin-coated pits. Binding to Reelin induces tyrosine phosphorylation of Dab1 and modulation of Tau phosphorylation (By similarity).
Cell surface receptor for Reelin (RELN) and apolipoprotein E (apoE)-containing ligands. Also binds alpha2-macroglobulin. LRP8 participates in transmitting the extracellular Reelin signal to intracellular signaling processes, by binding to DAB1 on its cytoplasmic tail. Reelin acts via both the VLDL receptor (VLDLR) and LRP8 to regulate DAB1 tyrosine phosphorylation and microtubule function in neurons. LRP8 has higher affinity for Reelin than VLDLR. LRP8 is thus a key component of the Reelin pathway which governs neuronal layering of the forebrain during embryonic brain development. Not required for endocytic uptake of SEPP1 in the kidney which is mediated by LRP2 (By similarity).
Binds LDL, the major cholesterol-carrying lipoprotein of plasma, and transports it into cells by endocytosis. In order to be internalized, the receptor-ligand complexes must first cluster into clathrin-coated pits.
(Microbial infection) Acts as a receptor for hepatitis C virus in hepatocytes, but not through a direct interaction with viral proteins.
(Microbial infection) Acts as a receptor for Vesicular stomatitis virus.
(Microbial infection) In case of HIV-1 infection, may function as a receptor for extracellular Tat in neurons, mediating its internalization in uninfected cells.
Cell surface receptor for Reelin (RELN) and apolipoprotein E (apoE)-containing ligands. LRP8 participates in transmitting the extracellular Reelin signal to intracellular signaling processes, by binding to DAB1 on its cytoplasmic tail. Reelin acts via both the VLDL receptor (VLDLR) and LRP8 to regulate DAB1 tyrosine phosphorylation and microtubule function in neurons. LRP8 has higher affinity for Reelin than VLDLR. LRP8 is thus a key component of the Reelin pathway which governs neuronal layering of the forebrain during embryonic brain development. Binds the endoplasmic reticulum resident receptor-associated protein (RAP). Binds dimers of beta 2-glycoprotein I and may be involved in the suppression of platelet aggregation in the vasculature. Highly expressed in the initial segment of the epididymis, where it affects the functional expression of clusterin and phospholipid hydroperoxide glutathione peroxidase (PHGPx), two proteins required for sperm maturation. May also function as an endocytic receptor. Not required for endocytic uptake of SEPP1 in the kidney which is mediated by LRP2 (By similarity). Together with its ligand, apolipoprotein E (apoE), may indirectly play a role in the suppression of the innate immune response by controlling the survival of myeloid-derived suppressor cells (By similarity).
Cell surface receptor for Reelin (RELN) and apolipoprotein E (apoE)-containing ligands. LRP8 participates in transmitting the extracellular Reelin signal to intracellular signaling processes, by binding to DAB1 on its cytoplasmic tail. Reelin acts via both the VLDL receptor (VLDLR) and LRP8 to regulate DAB1 tyrosine phosphorylation and microtubule function in neurons. LRP8 has higher affinity for Reelin than VLDLR. LRP8 is thus a key component of the Reelin pathway which governs neuronal layering of the forebrain during embryonic brain development. Binds the endoplasmic reticulum resident receptor-associated protein (RAP). Binds dimers of beta 2-glycoprotein I and may be involved in the suppression of platelet aggregation in the vasculature. Highly expressed in the initial segment of the epididymis, where it affects the functional expression of clusterin and phospholipid hydroperoxide glutathione peroxidase (PHGPx), two proteins required for sperm maturation (PubMed:12695510). May also function as an endocytic receptor. Not required for endocytic uptake of SEPP1 in the kidney which is mediated by LRP2 (PubMed:18174160). Together with its ligand, apolipoprotein E (apoE), may indirectly play a role in the suppression of the innate immune response by controlling the survival of myeloid-derived suppressor cells (PubMed:29336888).
Likely to be a multifunctional endocytic receptor, that may be implicated in the uptake of lipoproteins and of proteases. Binds LDL, the major cholesterol-carrying lipoprotein of plasma, and transports it into cells by endocytosis. Binds the receptor-associated protein (RAP). Could play a role in cell-cell interaction. May play a role in neural organization, as well as the establishment of embryonic organ systems. Involved in APP trafficking to and from the Golgi apparatus (By similarity). It probably acts as a sorting receptor that protects APP from trafficking to late endosome and from processing into amyloid beta (By similarity). Involved in the regulation of smooth muscle cells migration, probably through PLAUR binding and decreased internalization.
Likely to be a multifunctional endocytic receptor, that may be implicated in the uptake of lipoproteins and of proteases. Binds LDL, the major cholesterol-carrying lipoprotein of plasma, and transports it into cells by endocytosis. Binds the receptor-associated protein (RAP). Could play a role in cell-cell interaction. Involved in APP trafficking to and from the Golgi apparatus. It probably acts as a sorting receptor that protects APP from trafficking to late endosome and from processing into amyloid beta, thereby reducing the burden of amyloidogenic peptide formation. Involved in the regulation of smooth muscle cells migration, probably through PLAUR binding and decreased internalization.
Likely to be a multifunctional endocytic receptor, that may be implicated in the uptake of lipoproteins and of proteases. Binds LDL, the major cholesterol-carrying lipoprotein of plasma, and transports it into cells by endocytosis. Binds the receptor-associated protein (RAP). Could play a role in cell-cell interaction (By similarity). Involved in APP trafficking to and from the Golgi apparatus (By similarity). It probably acts as a sorting receptor that protects APP from trafficking to late endosome and from processing into amyloid beta (By similarity). Involved in the regulation of smooth muscle cells migration, probably through PLAUR binding and decreased internalization.
EGF stimulates the growth of various epidermal and epithelial tissues in vivo and in vitro and of some fibroblasts in cell culture. Magnesiotropic hormone that stimulates magnesium reabsorption in the renal distal convoluted tubule via engagement of EGFR and activation of the magnesium channel TRPM6 (By similarity).
Involved in the modulation of neuronal aggregation. May be involved in developmental events during the formation of the central nervous system (By similarity).
Probable receptor which is required for the oocyte-to-zygote transition although its exact function is controversial (By similarity). Seems to be required for fertilization probably by promoting the interaction or fusion between sperm and oocyte (PubMed:16360684). Conversely, shown to be dispensable for fertilization but required for the formation of a continuous and cohesive eggshell chitin layer by maintaining a homogenous distribution of chitin synthase chs-1 at the unfertilized oocyte cell membrane (By similarity). Appears to recruit or maintain together to the unfertilized oocyte cortex several proteins including chs-1, kinase mbk-2 and pseudophosphatases egg-3, and possibly egg-4 (By similarity).
Probable receptor which is required for the oocyte-to-zygote transition although its exact function is controversial (By similarity). Seems to be required for fertilization probably by promoting the interaction or fusion between sperm and oocyte (PubMed:16360684). Conversely, shown to be dispensable for fertilization but required for the formation of a continuous and cohesive eggshell chitin layer by maintaining a homogenous distribution of chitin synthase chs-1 at the unfertilized oocyte cell membrane (By similarity). Appears to recruit or maintain together to the unfertilized oocyte cortex several proteins including chs-1, kinase mbk-2 and pseudophosphatases egg-3, and possibly egg-4 and egg-5 (By similarity).
Degrades extracellular matrix. Proposed to play a role in breast cancer invasion and metastasis. Exhibits trypsin-like activity as defined by cleavage of synthetic substrates with Arg or Lys as the P1 site. Involved in the terminal differentiation of keratinocytes through prostasin (PRSS8) activation and filaggrin (FLG) processing.
Degrades extracellular matrix. Proposed to play a role in breast cancer invasion and metastasis. Exhibits trypsin-like activity as defined by cleavage of synthetic substrates with Arg or Lys as the P1 site (By similarity). Involved in the terminal differentiation of keratinocytes through prostasin (PRSS8) activation and filaggrin (FLG) processing (By similarity).
Degrades extracellular matrix. Exhibits trypsin-like activity as defined by cleavage of synthetic substrates with Arg or Lys as the P1 site (By similarity). Involved in the terminal differentiation of keratinocytes through prostasin (PRSS8) activation and filaggrin (FLG) processing (By similarity).
Integral component of basement membranes. Component of the glomerular basement membrane (GBM), responsible for the fixed negative electrostatic membrane charge, and which provides a barrier which is both size- and charge-selective. It serves as an attachment substrate for cells. Plays essential roles in vascularization. Critical for normal heart development and for regulating the vascular response to injury. Also required for avascular cartilage development (By similarity).
Endorepellin in an anti-angiogenic and anti-tumor peptide that inhibits endothelial cell migration, collagen-induced endothelial tube morphogenesis and blood vessel growth in the chorioallantoic membrane. Blocks endothelial cell adhesion to fibronectin and type I collagen. Anti-tumor agent in neovascularization. Interaction with its ligand, integrin alpha2/beta1, is required for the anti-angiogenic properties. Evokes a reduction in phosphorylation of receptor tyrosine kinases via alpha2/beta1 integrin-mediated activation of the tyrosine phosphatase, PTPN6 (By similarity).
The LG3 peptide has anti-angiogenic properties that require binding of calcium ions for full activity.
Serine-type endopeptidase involved in atrial natriuretic peptide hormone (NPPA) processing. Converts through proteolytic cleavage the non-functional propeptide NPPA into the active hormone, thereby regulating blood pressure in heart and promoting natriuresis, diuresis and vasodilation. Proteolytic cleavage of pro-NPPA also plays a role in female pregnancy by promoting trophoblast invasion and spiral artery remodeling in uterus. Also acts as a regulator of sodium reabsorption in kidney. May also process pro-NPPB the B-type natriuretic peptide.
Probable receptor, which may be involved in the internalization of lipophilic molecules and/or signal transduction. May act as a tumor suppressor (By similarity).
May influence APP processing, resulting in a decrease in sAPP-alpha production and increased amyloidogenic P3 peptide production.
Serine protease that plays a key role in innate immunity by activating the Toll pathway in response to infection with Gram-positive bacteria and fungi (PubMed:19590012, PubMed:24794300). During Gram-positive infection, acts downstream of PGRP-SA and upstream of Grass and Spz, and therefore appears to function in a pathway that links detection of Gram-positive lysine-type peptidoglycans to Toll activation (PubMed:19590012). Functions in a separate pathway to the psh-mediated activation of the Toll pathway (PubMed:19590012).
Probable receptor, which may be involved in the internalization of lipophilic molecules and/or signal transduction. May act as a tumor suppressor.
Enhances production and/or transport of FGF15 and thus has a role in regulation of bile acid synthesis.
Enhances production and/or transport of FGF19 and thus has a role in regulation of bile acid synthesis.
Component of the extracellular signaling pathway that establishes the dorsal-ventral pathway of the embryo. Three proteases; ndl, gd and snk process easter to create active easter. Active easter defines cell identities along the dorsal-ventral continuum by activating the spz ligand for the Tl receptor in the ventral region of the embryo. Nudel, pipe and windbeutel together trigger the protease cascade within the extraembryonic perivitelline compartment which induces dorsoventral polarity of the Drosophila embryo.
Probable receptor, which may be involved in the internalization of lipophilic molecules and/or signal transduction. Its precise role is however unclear, since it does not bind to very low density lipoprotein (VLDL) or to LRPAP1 in vitro (By similarity).
Serine protease which preferentially hydrolyzes peptides with Arg at the P1 position.

Catalytic Activity

Cleaves various synthetic substrates with Arg or Lys at the P1 position and prefers small side-chain amino acids, such as Ala and Gly, at the P2 position.

Biophysicochemical Properties

1.28 mM for pyroGlu-Phe-Lys-pNA.HCl
3.52 mM for pyroGlu-Pro-Arg-pNA.HCl
2.95 mM for H-D-Pro-Phe-Arg-pNA.2HCl
1.92 mM for Bz-Ile-Glu-(gamma-OR)-Gly-Arg-pNA.HCl
16 mM for pyroGlu-Gly-Arg-pNA.HCl
240 nM for Suc-Ala-Ala-Pro-Arg-pNA
534 nM for Suc-Ala-Ala-Pro-Lys-pNA

Subunit

Binds plasminogen, extracellular matrix components, plasminogen activator-plasminogen activator inhibitor type I complex, apolipoprotein E-enriched beta-VLDL, lipoprotein lipase, lactoferrin, CLU/clusterin and calcium. Forms a multimeric complex together with LRPAP1 (PubMed:1400426). Interacts (via PxLPxI/L motif) with ANKRA2 (via ankyrin repeats) (PubMed:22649097). Interacts with LRP2BP. Interacts (via NPXY motif) with DAB2; the interaction is not affected by tyrosine phosphorylation of the NPXY motif (By similarity). Interacts with MB (PubMed:12724130). Interacts with BMP4 (By similarity). Interacts with the Sonic hedgehog protein N-product which is the active product of SHH (By similarity). Interacts with CST3 in a calcium-dependent manner (PubMed:17462596). Interacts with the vitamin-D binding protein GC/DBP (By similarity). Interacts with sex hormone-binding protein SHBG (PubMed:16143106). Interacts with angiotensin-2 (By similarity). Also interacts with angiotensin 1-7 (By similarity). Interacts with APOM (By similarity). Interacts with selenoprotein SEPP1 (By similarity). Interacts with LEP (PubMed:17324488). Interacts with ALB (PubMed:18466341). Interacts with the antiapoptotic protein BIRC5/survivin (By similarity). Interacts with matrix metalloproteinase MMP2 in complex with metalloproteinase inhibitor TIMP1 (PubMed:28659595). In neurons, forms a trimeric complex with APP and APPB1/FE65 (By similarity). Interacts with LDLRAP1/ARH; mediates trafficking of LRP2 to the endocytic recycling compartment (PubMed:23836931). Does not interact with beta-amyloid protein 40 alone but interacts with the complex composed of beta-amyloid protein 40 and CLU/APOJ (By similarity). Interacts with MDK (By similarity).
Binds plasminogen, extracellular matrix components, plasminogen activator-plasminogen activator inhibitor type I complex, apolipoprotein E-enriched beta-VLDL, lipoprotein lipase, lactoferrin, CLU/clusterin and calcium. Forms a multimeric complex together with LRPAP1 (By similarity). Interacts (via PxLPxI/L motif) with ANKRA2 (via ankyrin repeats) (By similarity). Interacts with LRP2BP. Interacts (via NPXY motif) with DAB2; the interaction is not affected by tyrosine phosphorylation of the NPXY motif (PubMed:11247302). Interacts with MB (By similarity). Interacts with BMP4 (PubMed:15623804). Interacts with the Sonic hedgehog protein N-product which is the active product of SHH (PubMed:11964399). Interacts with CST3 in a calcium-dependent manner (By similarity). Interacts with the vitamin-D binding protein GC/DBP (PubMed:10052453). Interacts with sex hormone-binding protein SHBG (By similarity). Interacts with angiotensin-2 (PubMed:15467006). Also interacts with angiotensin 1-7 (PubMed:16380466). Interacts with APOM (PubMed:16099815). Interacts with selenoprotein SEPP1 (PubMed:18174160). Interacts with LEP (By similarity). Interacts with ALB (By similarity). Interacts with the antiapoptotic protein BIRC5/survivin (By similarity). Interacts with matrix metalloproteinase MMP2 in complex with metalloproteinase inhibitor TIMP1 (By similarity). In neurons, forms a trimeric complex with APP and APPB1/FE65 (PubMed:20637285). Interacts with LDLRAP1/ARH; mediates trafficking of LRP2 to the endocytic recycling compartment (By similarity). Does not interact with beta-amyloid protein 40 alone but interacts with the complex composed of beta-amyloid protein 40 and CLU/APOJ (By similarity). Interacts with MDK (PubMed:10772929).
Binds plasminogen, extracellular matrix components, plasminogen activator-plasminogen activator inhibitor type I complex, apolipoprotein E-enriched beta-VLDL, lipoprotein lipase, lactoferrin, CLU/clusterin and calcium (PubMed:7768901). Forms a multimeric complex together with LRPAP1 (PubMed:1400426). Interacts (via PxLPxI/L motif) with ANKRA2 (via ankyrin repeats) (By similarity). Interacts with LRP2BP (PubMed:12508107). Interacts (via NPXY motif) with DAB2; the interaction is not affected by tyrosine phosphorylation of the NPXY motif (PubMed:10769163, PubMed:15134832). Interacts with MB (By similarity). Interacts with BMP4 (By similarity). Interacts with the Sonic hedgehog protein N-product which is the active product of SHH (By similarity). Interacts with CST3 in a calcium-dependent manner (PubMed:17462596). Interacts with the vitamin-D binding protein GC/DBP (By similarity). Interacts with sex hormone-binding protein SHBG (PubMed:16143106). Interacts with angiotensin-2 (By similarity). Also interacts with angiotensin 1-7 (By similarity). Interacts with APOM (By similarity). Interacts with selenoprotein SEPP1 (By similarity). Interacts with LEP (By similarity). Interacts with ALB (By similarity). Interacts with the antiapoptotic protein BIRC5/survivin (PubMed:23825075). Interacts with matrix metalloproteinase MMP2 in complex with metalloproteinase inhibitor TIMP1 (By similarity). In neurons, forms a trimeric complex with APP and APPB1/FE65 (By similarity). Interacts with LDLRAP1/ARH; mediates trafficking of LRP2 to the endocytic recycling compartment (By similarity). Does not interact with beta-amyloid protein 40 alone but interacts with the complex composed of beta-amyloid protein 40 and CLU/APOJ (By similarity). Interacts with MDK (By similarity).
Binds plasminogen, extracellular matrix components, plasminogen activator-plasminogen activator inhibitor type I complex, apolipoprotein E-enriched beta-VLDL, lipoprotein lipase, lactoferrin, CLU/clusterin and calcium (By similarity). Forms a multimeric complex together with LRPAP1 (By similarity). Interacts (via PxLPxI/L motif) with ANKRA2 (via ankyrin repeats) (By similarity). Interacts with LRP2BP (By similarity). Interacts (via NPXY motif) with DAB2; the interaction is not affected by tyrosine phosphorylation of the NPXY motif (By similarity). Interacts with MB (By similarity). Interacts with BMP4 (By similarity). Interacts with the Sonic hedgehog protein N-product which is the active product of SHH (PubMed:11964399). Interacts with CST3 in a calcium-dependent manner (By similarity). Interacts with the vitamin-D binding protein GC/DBP (By similarity). Interacts with sex hormone-binding protein SHBG (By similarity). Interacts with angiotensin-2 (By similarity). Also interacts with angiotensin 1-7 (By similarity). Interacts with APOM (By similarity). Interacts with selenoprotein SEPP1 (By similarity). Interacts with LEP (By similarity). Interacts with ALB (By similarity). Interacts with the antiapoptotic protein BIRC5/survivin (By similarity). Interacts with matrix metalloproteinase MMP2 in complex with metalloproteinase inhibitor TIMP1 (By similarity). In neurons, forms a trimeric complex with APP and APPB1/FE65 (By similarity). Interacts with LDLRAP1/ARH; mediates trafficking of LRP2 to the endocytic recycling compartment (By similarity). Does not interact with beta-amyloid protein 40 alone but interacts with the complex composed of beta-amyloid protein 40 and CLU/APOJ (PubMed:9228033). Interacts with MDK (By similarity).
Heterodimer of an 85-kDa membrane-bound carboxyl subunit and a non-covalently attached 515-kDa N-terminal subunit. Found in a complex with PID1/PCLI1, LRP1 and CUBNI. Interacts with SNX17, PID1/PCLI1, PDGF and CUBN. The intracellular domain interacts with SHC1, GULP1 and DAB1. Interacts with LRPAP1 (By similarity). Intracellular domain interacts with MAFB. Can weakly interact (via NPXY motif) with DAB2 (via PID domain); the interaction is enhanced by tyrosine phosphorylation of the NPXY motif. Interacts with bacterial exotoxins. Interacts with MDK; promotes neuronal survival (PubMed:10772929).
Heterodimer of an 85-kDa membrane-bound carboxyl subunit and a non-covalently attached 515-kDa N-terminal subunit. Intracellular domain interacts with MAFB (By similarity). Found in a complex with PID1/PCLI1, LRP1 and CUBNI. Interacts with SNX17, PID1/PCLI1, PDGF and CUBN. The intracellular domain interacts with SHC1, GULP1 and DAB1. Interacts with LRPAP1. Can weakly interact (via NPXY motif) with DAB2 (via PID domain); the interaction is enhanced by tyrosine phosphorylation of the NPXY motif. Interacts with bacterial exotoxins. Interacts with MDK; promotes neuronal survival (PubMed:10772929).
Binds vitellogenin and LRPAP1 (alpha 2-macroglobulin).
Binds LRPAP1, PLAU, PLAT and SERPINE1; binding is followed by internalization and degradation of the ligands.
Homooligomer. Interacts with MUSK; the heterodimer forms an AGRIN receptor complex that binds AGRIN resulting in activation of MUSK (PubMed:18848351). Interacts (via the extracellular domain) with SOST; the interaction facilitates the inhibition of Wnt signaling (By similarity). Interacts with MESD; the interaction promotes glycosylation of LRP4 and its cell-surface expression (By similarity).
Homooligomer. Interacts with MUSK; the heterodimer forms an AGRIN receptor complex that binds AGRIN resulting in activation of MUSK (By similarity). Interacts (via the extracellular domain) with SOST; the interaction facilitates the inhibition of Wnt signaling (PubMed:21471202). Interacts with MESD; the interaction promotes glycosylation of LRP4 and its cell-surface expression (By similarity).
Homooligomer. Interacts with MUSK; the heterodimer forms an AGRIN receptor complex that binds AGRIN resulting in activation of MUSK. Interacts (via the extracellular domain) with SOST; the interaction facilitates the inhibition of Wnt signaling (By similarity). Interacts with MESD; the interaction promotes glycosylation of LRP4 and its cell-surface expression (PubMed:24140340).
Homodimer; disulfide-linked (By similarity). Forms phosphorylated oligomer aggregates on Wnt-signaling (By similarity). Component of the Wnt-Fzd-LRP5-LRP6 complex. Interacts (via the extracellular domain) with WNT1; the interaction is enhanced by prior formation of the Wnt/Fzd complex. Interacts (via the beta-propeller regions 3 and 4) with WNT3A. Interacts (via the beta-propeller regions 1 and 2) with WNT9B. Interacts with FZD5; the interaction forms a coreceptor complex for Wnt signaling and is inhibited by DKK1 and DRAXIN. Interacts (via beta propeller region) with DKK1; the interaction inhibits FZD5/LRP6 complex formation. Interacts with DKK2. Interacts (via the phosphorylated PPPSP motifs) with AXIN1; the interaction recruits the AXIN1/GSK3B complex to cell surface LRP6 signalsomes. Interacts (via the extracellular domain) with RSPO1; the interaction activates Wnt/beta-catenin signaling. Interacts (via the extracellular domain) with RSPO3 (via the cysteine rich domain); the interaction activates Wnt/beta-catenin signaling. Interacts (via the beta-propeller regions 1 and 2) with SOST; the interaction competes with DKK1 for binding for inhibiting beta-catenin signaling. Interacts (via the cytoplasmic domain) with CSNKIE; the interaction phosphorylates LRP6, binds AXIN1 and inhibits AXIN1/GSK3B-mediated phosphorylation of beta-catenin (By similarity). Interacts with DRAXIN; the interaction inhibits Wnt signaling. Interacts with GRB10; the interaction prevents AXIN1 binding, thus negatively regulating the Wnt signaling pathway. Interacts with MESD; the interaction prevents the formation of LRP6 aggregates and targets LRP6 to the plasma membrane. Interacts with MACF1. Interacts with DAB2; the interaction involves LRP6 phosphorylation by CK2 and sequesters LRP6 towards clathrin-mediated endocytosis. Interacts with TMEM198 (By similarity). Interacts with CAPRIN2; the interaction promotes LRP6 phosphorylation at Ser-1490 (By similarity). Found in a complex with CAPRIN2, CCNY and CDK14 during G2/M stage; CAPRIN2 functions as a scaffold for the complex by binding to CCNY via its N terminus and to CDK14 via its C terminus. Interacts with LYPD6. Forms a ternary complex with DKK1 and KREM1 (By similarity). Interacts with KREM1 in a DKK1-dependent manner (By similarity). Interacts with MDK: this interaction is calcium dependent (PubMed:12573468).
Homodimer; disulfide-linked. Forms phosphorylated oligomer aggregates on Wnt-signaling. Forms a WNT-signaling complex formed of a WNT protein, a FZD protein and LRP5 or LRP6. Interacts (via the extracellular domain) with WNT1; the interaction is enhanced by prior formation of the Wnt/Fzd complex. Interacts (via the beta-propeller regions 3 and 4) with WNT3A. Interacts (via the beta-propeller regions 1 and 2) with WNT9B. Interacts with FZD5; the interaction forms a coreceptor complex for Wnt signaling and is inhibited by DKK1 and DRAXIN. Interacts (via beta propeller region) with DKK1; the interaction inhibits FZD5/LRP6 complex formation. Interacts with DKK2. Interacts with C1orf187/DRAXIN; the interaction inhibits Wnt signaling (By similarity). Interacts (via the phosphorylated PPPSP motifs) with AXIN1; the interaction recruits the AXIN1/GSK3B complex to cell surface LRP6 signalsomes. Interacts with GRB10; the interaction prevents AXIN1 binding, thus negatively regulating the Wnt signaling pathway (By similarity). Interacts (via the extracellular domain) with RSPO1; the interaction activates Wnt/beta-catenin signaling. Interacts (via the extracellular domain) with RSPO3 (via the cysteine rich domain); the interaction activates Wnt/beta-catenin signaling. Interacts (via the beta-propeller regions 1 and 2) with SOST; the interaction competes with DKK1 for binding for inhibiting beta-catenin signaling. Interacts with MESD; the interaction prevents the formation of LRP6 aggregates and targets LRP6 to the plasma membrane (By similarity). Interacts (via the cytoplasmic domain) with CSNKIE; the interaction phosphorylates LRP6, binds AXIN1 and inhibits AXIN1/GSK3B-mediated phosphorylation of beta-catenin. Interacts with MACF1. Interacts with DAB2; the interaction involves LRP6 phosphorylation by CK2 and sequesters LRP6 towards clathrin-mediated endocytosis. Interacts with TMEM198. Interacts with CAPRIN2; the interaction promotes LRP6 phosphorylation at Ser-1490 (PubMed:18762581, PubMed:25331957). Found in a complex with CAPRIN2, CCNY and CDK14 during G2/M stage; CAPRIN2 functions as a scaffold for the complex by binding to CCNY via its N terminus and to CDK14 via its C terminus (PubMed:27821587). Interacts with LYPD6 (PubMed:23987510). Forms a ternary complex with DKK1 and KREM1 (PubMed:27524201). Interacts with KREM1 in a DKK1-dependent manner (PubMed:17804805). Interacts with MDK: this interaction is calcium dependent (By similarity).
Homodimer; disulfide-linked. Forms phosphorylated oligomer aggregates on Wnt-signaling (PubMed:12581525). Component of a WNT-signaling complex that contains a WNT protein, a FZD protein and LRP5 or LRP6. Interacts with FZD8; the interaction is formed on WNT-binding and signaling. Interacts (via the phosphorylated PPPSP motif domains) with AXIN1; the interaction prevents inhibition of beta-catenin phosphorylation and signaling and is enhanced in the presence of GSK3B and WNT1 or WNT3A. Interacts (via beta-propeller regions 3 and 4) with DKK1; the interaction, enhanced by MESD and/or KREMEN, inhibits beta-catenin signaling by preventing GSK3-mediated phosphorylation of the PPPSP motifs and subsequent, AXIN1 binding. Interacts with CSNK1E. Interacts with SOST; the interaction antagonizes canonical Wnt signaling. Interacts with APCDD1 (By similarity). Interacts with MESD; the interaction prevents the formation of LRP5 aggregates, targets LRP5 to the plasma membrane and, when complexed with KREMEN2, increases DKK1 binding (PubMed:12581525). Interacts with CAPRIN2 (By similarity).
Homodimer; disulfide-linked. Forms phosphorylated oligomer aggregates on Wnt-signaling (By similarity). Component of a Wnt-signaling complex that contains a WNT protein, a FZD protein and LRP5 or LRP6. Interacts with FZD8; the interaction is formed on WNT-binding and signaling (PubMed:11448771). Interacts (via the phosphorylated PPPSP motif domains) with AXIN1; the interaction prevents inhibition of beta-catenin phosphorylation and signaling and is enhanced in the presence of GSK3B and WNT1 or WNT3A (PubMed:11336703, PubMed:14731402). Interacts (via beta-propeller regions 3 and 4) with DKK1; the interaction, enhanced by MESD and/or KREMEN, inhibits beta-catenin signaling by preventing GSK3-mediated phosphorylation of the PPPSP motifs and subsequent, AXIN1 binding (PubMed:11448771, PubMed:15778503, PubMed:19746449). Interacts with MESD; the interaction prevents the formation of LRP5 aggregates, targets LRP5 to the plasma membrane and, when complexed with KREMEN2, increases DKK1 binding (PubMed:17488095, PubMed:19746449, PubMed:15143163). Interacts with CSNK1E (PubMed:16513652). Interacts with SOST; the interaction antagonizes canonical Wnt signaling (PubMed:15778503, PubMed:15908424). Interacts with APCDD1 (PubMed:20393562). Interacts with CAPRIN2 (PubMed:18762581).
Binds to the extracellular matrix protein Reelin. Interacts with DAB1. Interacts with VLDLR. Interacts with SNX17 (By similarity). Interacts with PCSK9 (By similarity).
Binds to the extracellular matrix protein Reelin. Interacts with DAB1. Interacts with VLDLR. Interacts with SNX17. Interacts with PCSK9 (By similarity).
Binds to the extracellular matrix protein Reelin. Interacts with VLDLR. Interacts with SNX17 (By similarity). Interacts with DAB1. Receptor for the minor-group human rhinoviruses (HRVs); binds protein VP1 through the second and third LDL-receptor class A domains. Interacts with PCSK9.
Binds to the extracellular matrix protein Reelin. Interacts with LDLRAP1 (By similarity).
Reelin associates with two or more receptor molecules. Interacts with DAB1 and JNK-interacting proteins (By similarity).
Interacts (via NPXY motif) with DAB2 (via PID domain); the interaction is impaired by tyrosine phosphorylation of the NPXY motif. Interacts (via NPXY motif) with LDLRAP1 (via PID domain). Interacts with ARRB1. Interacts with SNX17. Interacts with the full-length immature form of PCSK9 (via C-terminus).
Interacts (via NPXY motif) with DAB2 (via PID domain); the interaction is impaired by tyrosine phosphorylation of the NPXY motif (PubMed:11247302). Interacts (via NPXY motif) with LDLRAP1 (via PID domain) (By similarity). Interacts with ARRB1 (By similarity). Interacts with SNX17 (PubMed:12169628). Interacts with the full-length immature form of PCSK9 (via C-terminus) (By similarity).
Interacts with ldlrap1.
Interacts (via NPXY motif) with DAB2 (via PID domain); the interaction is impaired by tyrosine phosphorylation of the NPXY motif (By similarity). Interacts (via NPXY motif) with LDLRAP1 (via PID domain) (PubMed:12221107, PubMed:22509010). Interacts with ARRB1 (PubMed:12944399). Interacts with SNX17 (PubMed:14739284). Interacts with the full-length immature form of PCSK9 (via C-terminus) (PubMed:17461796, PubMed:21149300).
(Microbial infection) Interacts with vesicular stomatitis virus glycoprotein.
(Microbial infection) May interact with HIV-1 Tat.
Reelin associates with two or more receptor molecules. Interacts with DAB1 and JNK-interacting proteins. Interacts with SNX17 (By similarity). Interacts with PCSK9. Interacts with MDK; this interaction is calcium dependent (By similarity).
Reelin associates with two or more receptor molecules. Interacts with DAB1 and JNK-interacting proteins. Interacts with SNX17. Interacts with PCSK9 (By similarity). Interacts with MDK; this interaction is calcium dependent (PubMed:12573468).
Interacts (via NPXY motif) with DAB2 (via PID domain); the interaction is impaired by tyrosine phosphorylation of the NPXY motif (By similarity). Interacts (via NPXY motif) with LDLRAP1 (via PID domain). Interacts with ARRB1. Interacts with SNX17. Interacts with the full-length immature form of PCSK9 (via C-terminus) (By similarity).
Interacts with GGA1 and ROCK2 (By similarity). Interacts with APP. Interacts with PLAUR (By similarity).
Interacts with GGA1 and ROCK2. Interacts with PLAUR. Interacts with APP.
Interacts with GGA1 and ROCK2. Interacts with APP. Interacts with PLAUR.
Interacts with EGFR and promotes EGFR dimerization. Interacts with RHBDF1; may retain EGF in the endoplasmic reticulum and regulates its degradation through the endoplasmic reticulum-associated degradation (ERAD) (By similarity). Interacts with RHBDF2 (By similarity).
Interacts with FBLN1 and LGALS3BP. Interacts with PLXDC1.
Interacts with FBLN1 and LGALS3BP (By similarity). Interacts with PLXDC1.
Purified perlecan has a strong tendency to aggregate in dimers or stellate structures. It interacts with other basement membrane components such as laminin, prolargin and collagen type IV. Interacts with COL13A1, FGFBP1 and VWA1. Interacts (via C-terminus) with ECM1 (via C-terminus).
Interacts with CDCP1. May interact with TMEFF1.
Interacts with CDCP1. May interact with TMEFF1 (By similarity).
Purified perlecan has a strong tendency to aggregate in dimers or stellate structures. It interacts with other basement membrane components such as laminin, prolargin and collagen type IV. Interacts with COL13A1, FGFBP1 and VWA1. Interacts (via C-terminus) with ECM1 (via C-terminus) (By similarity).
May interact with RACK1, ZFYVE9 and NMRK2.
Interacts with APP precursor C-terminus.
Interacts with FGF15.
Interacts with FGF19.
Binds GGA1 and GGA2.
Forms a heterodimer with SERPINA5.

Miscellaneous

The gene is preferentially inactivated in one histological type of lung cancer (non-small cell lung cancer (NSCLC)). May thus play an important role in tumorigenesis of NSCLCs.
LRP8 and VLVLR together are required for correct embryonic development in the brain. Targeted disruption of both genes results in a phenotype virtually indistinguishable from that seen in "reeler" and "scrambler" mice. Subtle effects of VLDLR deletion are found mainly in the cerebellum, whereas lack of LRP8 predominantly affects the positioning of the neurons in the neocortex.
Natural isoforms of apoE (E2, E3, E4) have similar affinities for LRP8.
Initially named CORIN due to its abundant expression in the heart.
The LG3 peptide has been found in the urine of patients with end-stage renal disease and in the amniotic fluid of pregnant women with premature rupture of fetal membranes.
Corin is disrupted in C57BL/6-Kit(W-sh/W-sh) mice, a genetic inversion used as mast cell-deficient model. Phenotypes in C57BL/6-Kit(W-sh/W-sh) mice are mainly due to the absence of Kit, a receptor for mast cell development. The absence of Corin probably leads to immediate significant cardiac hypertrophy and contractile dysfunction in response to pressure overload (PubMed:21903139).

Similarity

Belongs to the LDLR family.
Belongs to the VPS10-related sortilin family. SORL1 subfamily.
Belongs to the thrombospondin family.
Belongs to the G-protein coupled receptor 1 family.
Belongs to the peptidase S1 family.

Keywords

3D-structure   Calcium   Cell membrane   Cell projection   Coated pit   Complete proteome   Disulfide bond   EGF-like domain   Endocytosis   Endosome   Glycoprotein   Hearing   Membrane   Metal-binding   Neurogenesis   Phosphoprotein   Receptor   Reference proteome   Repeat   SH3-binding   Signal   Transmembrane   Transmembrane helix   Transport   Disease mutation   Polymorphism   Acetylation   Cytoplasm   Developmental protein   Nucleus   Alternative splicing   Direct protein sequencing   Differentiation   Wnt signaling pathway   Congenital myasthenic syndrome   Endoplasmic reticulum   Isopeptide bond   Lipoprotein   Palmitate   Ubl conjugation   Osteogenesis imperfecta   Osteopetrosis   Cholesterol metabolism   Lipid metabolism   Lipid transport   Steroid metabolism   Sterol metabolism   VLDL   Mental retardation   Golgi apparatus   LDL   Lysosome   Host cell receptor for virus entry   Host-virus interaction   Secreted   Cleavage on pair of basic residues   Alzheimer disease   Amyloidosis   Neurodegeneration   Growth factor   Cell adhesion   G-protein coupled receptor   Leucine-rich repeat   Transducer   Basement membrane   Extracellular matrix   Sulfation   Fertilization   Signal-anchor   Autocatalytic cleavage   Hydrolase   Protease   Serine protease   Zymogen   Angiogenesis   Heparan sulfate   Immunoglobulin domain   Laminin EGF-like domain   Proteoglycan   Hypotrichosis   Ichthyosis   Cytoplasmic vesicle   Immunity   Innate immunity   Sushi  

Feature

chain  Low-density lipoprotein receptor-related protein 2
sequence variant  In dbSNP:rs2229263.
splice variant  In isoform 2.
propeptide  Removed in mature form

Uniprot

P98158.1   A2ARV4.1   P98164.3   C0HL13.1   Q04833.1   Q91ZX7.1   + More
Q07954.2   P98157.1   Q9NZR2.2   Q9JI18.1   Q9QYP1.2   O75096.4   Q8VI56.3   O88572.1   O75581.2   Q91VN0.3   O75197.2   Q6X0I2.1   P98163.2   P35953.1   P98156.1   P98155.1   P98166.1   P98165.1   Q98931.1   P20063.1   P35951.2   Q99087.1   P01130.1   Q28832.2   Q14114.4   Q924X6.2   Q99088.1   P35952.1   P01131.2   P35950.2   O88307.3   Q92673.2   Q95209.1   Q98930.1   Q95ND4.1   Q2PC93.1   P46023.1   Q700K0.1   A2VEC9.2   P98167.2   Q8CG65.2   P10493.2   P14543.3   E3LYX0.1   A8X765.2   Q9Y5Q5.2   P98160.4   Q9Y5Y6.2   Q0IIH7.1   P56677.2   Q05793.1   Q80YN4.2   Q5R662.2   Q9BE74.2   Q86YD5.3   Q9VER6.2   A2AR95.1   Q9Y561.1   Q9Z319.2   A4IHY6.1   A2AJX4.2   Q8BUJ9.2   Q5VYJ5.4   P98159.2   O88204.1   O75074.2   Q8BIK6.3  

EC Number

3.4.21.-
3.4.21.109

Pubmed

7937880    6752952    1400426    7510321    7544804    11964399    + More
12519751    12724130    15126248    15467006    16143106    16380466    17063000    16801528    16099815    17462596    17846082    18466341    17324488    19202329    22673903    23836931    28659595    17245526    22649097    19468303    16141072    10766831    10052453    10772929    11247302    15623804    18174160    19349973    21183079    20460439    20637285    22841573    22340494    22354480    23825075    24825475    24639464    26439398    26822476    27773703    8706697    15815621    7959795    8187828    7768901    10769163    12508107    15134832    27798286    23275343    16959974    17632512    21248752    23992033    26529358    9228033    8506301    9851916    12754521    15888633    17761667    8485155    12151109    1618748    15135046    1423604    8490961    19144319    19656770    18276581    23806337    3266596    7534747    9782078    16541075    15489334    2597675    1698775    2112085    1702392    11729193    11854294    11907044    12888553    12713657    15272003    15769472    16335952    17124247    19159218    19139490    21269460    24275569    10318830    10652313    11735395    16938309    23033978    26142438    7506255    9790844    10766186    11031110    11384978    15057822    9693030    18848351    16554811    20381006    21471202    24234652    16517118    14621295    24140340    9704021    12581525    12573468    15142971    16543246    17376403    17698587    19857465    15469977    18505367    11448771    11357136    12857724    15778503    15908424    16341017    16815997    16513652    17400545    17326769    17804805    17569865    18362152    18762581    19107203    18378904    20059949    19801552    19293931    20093360    21536646    22491013    22575959    23987510    23186163    25331957    27821587    27524201    22000856    17332414    23703864    26387593    9714764    10049586    11719191    11956231    9790987    11401438    12509515    17488095    19746449    11336703    14731402    15143163    20393562    11741193    12579474    15024691    15077203    15346351    16252235    16679074    18602879    16929062    25920554    27228167    15981244    19177549    20340138    19324841    15824851    15824861    16234968    17295608    14727154    24715757    12015390    17437160    24706814    28375157    15056367    7878005    10731132    12537572    18327897    1384047    7925422    8013374    7919660    10571241    12169628    12746448    20427281    8128315    8069294    8294473    8020981    15164053    12857919    18039658    15064754    10391209    16080122    7929362    7957081    1655760    8662771    11294845    3010466    8466528    1475710    1709931    6091915    2988123    14702039    15057824    8127891    3005267    3104336    10535997    11100124    12221107    12944399    12754519    12615904    14739284    15592455    17461796    19520913    21149300    23589850    25944712    7603991    7578052    9262405    10933493    12459547    22509010    1301956    9016531    3263645    2569482    3955657    8347689    2318961    1446662    1867200    8462973    8168830    2726768    1464748    7573037    7583548    7550239    7635461    7635482    7649546    7649549    8740918    8664907    9026534    9254862    9143924    9259195    9104431    9654205    9452094    9452095    9452118    10206683    10660340    9852677    9678702    10532689    10422803    10090484    10447263    10978268    10980548    10882754    11298688    11462246    17142622    17347910    19318025    19319977    21418584    22160468    24529145    25545329    25378237    9556295    10064736    8344216    8626535    9079678    11152697    16710414    10218790    12681505    10508213    12899622    12950167    12807892    12399018    17847002    9685741    12871934    12426372    12695510    10380922    10827199    29336888    2922268    16641100    19393038    6313699    6327078    6143315    3755212    21804562    1527478    3785227    9726247    9510025    14764453    16174740    9157966    8940146    18562096    20068231    21220680    21147781    23565137    20015111    18407551    22472873    8798746    8197140    12853948    17126404    30520531    26477546    11008217    8743952    12909363    3264556    2496973    8224873    7601446    3084254    8326911    9299350    9501082    11589703    16574105    11427896    2574658    7557988    1906509    2471408    16360684    14624247    10329693    11082206    10880574    14559895    17660514    19751717    21288900    21518754    22437503    17918732    1569102    1730768    8234307    11101850    1685141    1679749    2687294    15591058    12435733    11148217    11279527    11956183    12604605    17105986    18024432    19789387    22171320    21996443    10373424    10500122    10373425    16007225    16407223    18843291    11696548    17273967    10199918    1744087    2972708    7649154    10545953    16407285    18694874    15155264    20613715    16303743    21795536    12537569    19590012    24794300    9927190    16421571    12809483    9756624    11884416    15637153    21903139    22418978    23747249    10744778    15164054    7671306    9477324    9693042    11390366    15853774   

EMBL

L34049    AL845489    AK166702    Y08566    AF197160    U33837    + More
AC007556    AC008178    U04441    S73145    GL881906    M96150    Z73907    X67469    AF367720    AF369477    AF369389    AF369390    AF369391    AF369392    AF369393    AF369394    AF369395    AF369396    AF369397    AF369398    AF369399    AF369400    AF369401    AF369402    AF369403    AF369404    AF369405    AF369406    AF369407    AF369408    AF369409    AF369410    AF369411    AF369412    AF369413    AF369414    AF369415    AF369416    AF369417    AF369418    AF369419    AF369420    AF369421    AF369422    AF369423    AF369424    AF369425    AF369426    AF369427    AF369428    AF369429    AF369430    AF369431    AF369432    AF369433    AF369434    AF369435    AF369436    AF369437    AF369438    AF369439    AF369440    AF369441    AF369442    AF369443    AF369444    AF369445    AF369446    AF369447    AF369448    AF369449    AF369450    AF369451    AF369452    AF369453    AF369454    AF369455    AF369456    AF369457    AF369458    AF369459    AF369460    AF369461    AF369462    AF369463    AF369464    AF369465    AF369466    AF369467    AF369468    AF369469    AF369470    AF369471    AF369472    AF369473    AF369474    AF369475    AF369476    AAL09566.1    AAL09567.1    CAA47817.1    X13916    AF058427    DQ314873    AC023237    AC137628    AC137834    BC045107    X15424    Y18524    X74904    AF176832    AF283343    AF283342    AF283327    AF283328    AF283329    AF283330    AF283331    AF283332    AF283333    AF283334    AF283335    AF283336    AF283337    AF283338    AF283339    AF283340    AF283341    AF283374    AF283344    AF283345    AF283346    AF283347    AF283348    AF283349    AF283350    AF283351    AF283352    AF283353    AF283354    AF283355    AF283356    AF283357    AF283358    AF283359    AF283360    AF283361    AF283362    AF283363    AF283364    AF283366    AF283367    AF283368    AF283369    AF283370    AF283371    AF283372    AF283373    AF283408    AF283376    AF283377    AF283378    AF283379    AF283380    AF283381    AF283382    AF283383    AF283384    AF283385    AF283386    AF283387    AF283388    AF283389    AF283390    AF283391    AF283392    AF283393    AF283394    AF283395    AF283396    AF283397    AF283398    AF283399    AF283400    AF283401    AF283402    AF283403    AF283404    AF283405    AF283406    AF283407    AF270884    AK035795    AK034122    AABR03025549    AABR03027097    AABR03027512    AABR03029369    AB011533    AB084910    AB011540    AB231861    AC021573    BC037360    BC041048    BC136667    BC136668    AF247637    AL691489    AL732478    BC132240    AK032360    AK036406    AK129224    AF074265    BC060704    AF074264    AC007537    AC007621    BC117136    BC126405    AF064984    AF077847    AC112990    AC117797    BC011374    AF077820    AF064548    AF283321    AF283320    AB017498    AP000807    CH471076    BC150595    AY262832    AAP92450.1    U13637    AE014298    BT003478    D11100    L33417    U06670    S73732    L20470    S73849    D16532    D16493    D16494    L22431    DQ067198    AL450467    CH471071    BC136562    L35767    X80207    X97001    M11501    Z19521    X64414    AC161371    CH466522    BC053041    M62976    L00352    L00336    L00337    L00338    L00339    L00340    L00341    L00343    L00344    L00345    L00346    L00347    L00348    L00349    L00350    L00351    L29401    AY114155    AK295612    AK296312    AK299038    AK300313    BT007361    AY324609    AB209409    FJ525879    AC011485    CH471106    BC014514    AF065990    AF067952    AF118147    S64272    AAC17444.1    AAD13300.1    D50678    D86407    Z75190    AL355483    AL606760    BC006443    BC051836    D85463    AJ312058    M62978    X13722    DAAA02019482    K01830    K01429    M29843    JH000173    M94387    M13877    AB015790    AK147303    AF031816    Y12004    Y08110    U60975    AP000664    AP000977    CH471065    BC137171    D86350    Y08109    AB050947    AJ866919    Z23104    AJ629845    AB111888    AC004877    KF459635    KF495712    KF459640    BN000852    AJ416457    X93922    AJ491857    AC153815    X14194    X14480    AK041633    AK084876    AK144878    AK166779    BC131669    AH003206    X83093    M30269    X82245    X84819    X84820    X84821    X84822    X84823    X84824    X84825    X84826    X84827    X84828    X84829    X84830    X84831    X84832    X84833    X84834    X84835    X84836    X84837    AL122018    AL139161    BC045606    AB209448    M27445    DS268419    EFO86538.1    HE601197    AF133845    AC092597    AC104646    AC107068    EU326305    BC110451    AF113248    M85289    X62515    AL590556    AL590103    L22078    AL445795    S76436    M64283    AF118224    AF133086    AB030036    AF057145    BC005826    BC030532    AF283256    BC122638    AF042822    BC005496    M77174    J04054    J04055    AY251285    AC121481    CR860634    CR860720    AB056772    AK293930    AK075546    AC026269    AC087277    AC129502    AL136146    CH471064    BC042754    BC136286    BC143824    AE014297    AY118964    BT011129    AAM50824.1    AAR82796.1    AK029683    AK032208    AL845300    BX322585    BX571894    AF166350    AK289752    AK299374    AC087370    AC090827    AP002847    CH471060    BC032109    AAD44360.1    AB013874    AC129608    AC161529    CH466524    BC093485    BC138339    BC138340    BC135753    KC836882    AL772224    AL844839    AL845271    AL845417    AL845543    AL928841    AL935116    AGN95783.1    AK050512    AK084675    BC058345    KC843478    AL157895    AL353147    AL354695    AL357520    AL391992    AL450470    AL589943    AL590378    KF455210    U29153    AE014296    AB009463    AB009462    BC007408    AK074751    AK296536    DQ061860    AC166572    AK045663   

Proteomes

UP000002494    UP000000589    UP000005640    UP000008227    UP000001940    UP000000539    + More
UP000000803    UP000001811    UP000009136    UP000001075    UP000011712    UP000008281    UP000008549    UP000001595    UP000233100    UP000008143   

PRIDE

P98158    A2ARV4    P98164    Q04833    Q91ZX7    Q07954    + More
P98157    Q9NZR2    Q9JI18    Q9QYP1    O75096    Q8VI56    O88572    O75581    Q91VN0    O75197    Q6X0I2    P98163    P35953    P98156    P98155    P98166    P98165    Q98931    P20063    P35951    P01130    Q28832    Q14114    Q924X6    Q99088    P35952    P01131    P35950    O88307    Q92673    Q95209    Q98930    Q95ND4    Q2PC93    P46023    Q700K0    A2VEC9    P98167    Q8CG65    P10493    P14543    Q9Y5Q5    P98160    Q9Y5Y6    Q0IIH7    P56677    Q05793    Q80YN4    Q86YD5    Q9VER6    A2AR95    Q9Y561    Q9Z319    A4IHY6    A2AJX4    Q8BUJ9    Q5VYJ5    P98159    O88204    O75074    Q8BIK6   

Pfam

PF00058   Ldl_recept_b        + More
PF07645   EGF_CA
PF12662   cEGF
PF00057   Ldl_recept_a
PF16472   DUF5050
PF00008   EGF
PF00041   fn3
PF15902   Sortilin-Vps10
PF15901   Sortilin_C
PF01826   TIL
PF00093   VWC
PF00094   VWD
PF00754   F5_F8_type_C
PF00090   TSP_1
PF12799   LRR_4
PF00001   7tm_1
PF13855   LRR_8
PF08742   C8
PF07474   G2F
PF00086   Thyroglobulin_1
PF12947   EGF_3
PF06119   NIDO
PF01392   Fz
PF15494   SRCR_2
PF00089   Trypsin
PF13895   Ig_2
PF00053   Laminin_EGF
PF07679   I-set
PF00052   Laminin_B
PF00054   Laminin_G_1
PF00431   CUB
PF01390   SEA
PF00084   Sushi
PF00629   MAM
PF09342   DUF1986

Interpro

IPR001881   EGF-like_Ca-bd_dom        + More
IPR013032   EGF-like_CS       
IPR018097   EGF_Ca-bd_CS       
IPR000033   LDLR_classB_rpt       
IPR011042   6-blade_b-propeller_TolB-like       
IPR036055   LDL_receptor-like_sf       
IPR002172   LDrepeatLR_classA_rpt       
IPR000742   EGF-like_dom       
IPR000152   EGF-type_Asp/Asn_hydroxyl_site       
IPR009030   Growth_fac_rcpt_cys_sf       
IPR023415   LDLR_class-A_CS       
IPR026823   cEGF       
IPR019825   Lectin_legB_Mn/Ca_BS       
IPR032485   DUF5050       
IPR017049   LRP5/6       
IPR032931   VLDLR       
IPR031777   Sortilin_C       
IPR015943   WD40/YVTN_repeat-like_dom_sf       
IPR006581   VPS10       
IPR013783   Ig-like_fold       
IPR003961   FN3_dom       
IPR036116   FN3_sf       
IPR031778   Sortilin_N       
IPR016317   Pro-epidermal_GF       
IPR008979   Galactose-bd-like_sf       
IPR001846   VWF_type-D       
IPR000884   TSP1_rpt       
IPR000421   FA58C       
IPR014853   Unchr_dom_Cys-rich       
IPR006207   Cys_knot_C       
IPR030119   SCO-spondin       
IPR001007   VWF_dom       
IPR036383   TSP1_rpt_sf       
IPR002919   TIL_dom       
IPR036084   Ser_inhib-like_sf       
IPR000372   LRRNT       
IPR001611   Leu-rich_rpt       
IPR003591   Leu-rich_rpt_typical-subtyp       
IPR032675   LRR_dom_sf       
IPR025875   Leu-rich_rpt_4       
IPR000276   GPCR_Rhodpsn       
IPR017452   GPCR_Rhodpsn_7TM       
IPR036201   Pacifastin_dom_sf       
IPR024731   EGF_dom       
IPR006605   G2_nidogen/fibulin_G2F       
IPR009017   GFP       
IPR000716   Thyroglobulin_1       
IPR036857   Thyroglobulin_1_sf       
IPR003886   NIDO_dom       
IPR041762   Corin_CRD_1       
IPR009003   Peptidase_S1_PA       
IPR020067   Frizzled_dom       
IPR036772   SRCR-like_dom_sf       
IPR001254   Trypsin_dom       
IPR017052   Corin       
IPR036790   Frizzled_dom_sf       
IPR017448   SRCR-like_dom       
IPR033116   TRYPSIN_SER       
IPR041763   Corin_CRD_2       
IPR013106   Ig_V-set       
IPR003598   Ig_sub2       
IPR001791   Laminin_G       
IPR036179   Ig-like_dom_sf       
IPR000082   SEA_dom       
IPR003599   Ig_sub       
IPR007110   Ig-like_dom       
IPR002049   Laminin_EGF       
IPR000034   Laminin_IV       
IPR013320   ConA-like_dom_sf       
IPR013098   Ig_I-set       
IPR017051   Peptidase_S1A_matripase       
IPR018114   TRYPSIN_HIS       
IPR036364   SEA_dom_sf       
IPR035914   Sperma_CUB_dom_sf       
IPR000859   CUB_dom       
IPR001190   SRCR       
IPR000436   Sushi_SCR_CCP_dom       
IPR035976   Sushi/SCR/CCP_sf       
IPR000998   MAM_dom       
IPR034381   Nudel       
IPR015420   Peptidase_S1A_nudel       
IPR001314   Peptidase_S1A       

SUPFAM

SSF57424   SSF57424        + More
SSF57184   SSF57184       
SSF49265   SSF49265       
SSF82895   SSF82895       
SSF49785   SSF49785       
SSF57567   SSF57567       
SSF57283   SSF57283       
SSF54511   SSF54511       
SSF57610   SSF57610       
SSF56487   SSF56487       
SSF63501   SSF63501       
SSF50494   SSF50494       
SSF49899   SSF49899       
SSF48726   SSF48726       
SSF49854   SSF49854       
SSF82671   SSF82671       
SSF57535   SSF57535       

Gene 3D

2.120.10.30     4.10.400.10     2.130.10.10     2.60.40.10     2.20.100.10     2.60.120.260     3.80.10.10     4.10.800.10     1.10.2000.10     2.60.120.290     3.30.70.960    

CDD

cd00112  LDLa
cd00063  FN3
cd00057  FA58C
cd00191  TY
cd00255  nidG2
cd07888  CRD_corin_2
cd00190  Tryp_SPc
cd07445  CRD_corin_1
cd00041  CUB
cd00033  CCP
cd06263  MAM

ProteinModelPortal

P98158.1   A2ARV4.1   P98164.3   C0HL13.1   Q04833.1   Q91ZX7.1   + More
Q07954.2   P98157.1   Q9NZR2.2   Q9JI18.1   Q9QYP1.2   O75096.4   Q8VI56.3   O88572.1   O75581.2   Q91VN0.3   O75197.2   Q6X0I2.1   P98163.2   P35953.1   P98156.1   P98155.1   P98166.1   P98165.1   Q98931.1   P20063.1   P35951.2   Q99087.1   P01130.1   Q28832.2   Q14114.4   Q924X6.2   Q99088.1   P35952.1   P01131.2   P35950.2   O88307.3   Q92673.2   Q95209.1   Q98930.1   Q95ND4.1   Q2PC93.1   P46023.1   Q700K0.1   A2VEC9.2   P98167.2   Q8CG65.2   P10493.2   P14543.3   E3LYX0.1   A8X765.2   Q9Y5Q5.2   P98160.4   Q9Y5Y6.2   Q0IIH7.1   P56677.2   Q05793.1   Q80YN4.2   Q5R662.2   Q9BE74.2   Q86YD5.3   Q9VER6.2   A2AR95.1   Q9Y561.1   Q9Z319.2   A4IHY6.1   A2AJX4.2   Q8BUJ9.2   Q5VYJ5.4   P98159.2   O88204.1   O75074.2   Q8BIK6.3  

PDB

3M0C     E-value=7.75405e-112,     Score=1042

KEGG

101739353    K06233 low density lipoprotein-related protein 2 | (RefSeq) low-density lipoprotein receptor-related

GO

GO:0017124   GO:0050769   GO:0060982   GO:0061642   GO:0038023   GO:0030165   GO:0042562   GO:0005737   GO:0005905   GO:0005509   GO:0032526   GO:0016197   GO:0006898   GO:0010165   GO:0030424   GO:0003148   GO:0009986   GO:0030425   GO:0003139   GO:1904447   GO:0061156   GO:0050750   GO:0046879   GO:0007568   GO:0010951   GO:0008144   GO:0005768   GO:0007605   GO:0016020   GO:0031904   GO:0060068   GO:0001843   GO:0045056   GO:0044877   GO:0030001   GO:0045121   GO:0009897   GO:0140077   GO:0005615   GO:0044295   GO:0003223   GO:0070447   GO:0006766   GO:0008584   GO:0020028   GO:0033280   GO:0035258   GO:0030514   GO:0042493   GO:0045807   GO:0005903   GO:0031100   GO:0032991   GO:0030492   GO:0016324   GO:0140058   GO:0016021   GO:0031526   GO:0006897   GO:0005794   GO:0051087   GO:0060976   GO:0030139   GO:0003281   GO:0007507   GO:0030900   GO:0045177   GO:0035904   GO:0005783   GO:0043235   GO:0008283   GO:0005764   GO:0061024   GO:0042359   GO:1905167   GO:0030665   GO:0005765   GO:0001523   GO:0070062   GO:0006629   GO:0005886   GO:0002119   GO:0040017   GO:0040018   GO:0015918   GO:0015248   GO:0030334   GO:0042395   GO:0051481   GO:0038024   GO:0005634   GO:0030178   GO:0048691   GO:0002020   GO:0008203   GO:0032956   GO:0060548   GO:0016323   GO:0150093   GO:0035909   GO:0043066   GO:0043025   GO:0150094   GO:0010976   GO:0016964   GO:0043524   GO:0032374   GO:0003279   GO:0070374   GO:0007041   GO:1904109   GO:0030136   GO:0035774   GO:0005769   GO:0032050   GO:0051895   GO:0051222   GO:1904209   GO:0002265   GO:1903078   GO:0043277   GO:0010812   GO:0045773   GO:0097242   GO:0032092   GO:0010875   GO:1904754   GO:0010977   GO:0044242   GO:0015026   GO:0014912   GO:2000587   GO:0048471   GO:1900149   GO:0007205   GO:0048694   GO:1904646   GO:0032429   GO:0032370   GO:0006909   GO:0034185   GO:0050766   GO:0032593   GO:0005887   GO:0010942   GO:0007204   GO:0005044   GO:0005041   GO:0003723   GO:0030666   GO:0070325   GO:0010715   GO:0042157   GO:0043395   GO:0030226   GO:0021987   GO:0001540   GO:0031623   GO:0098797   GO:1900223   GO:0042953   GO:0005925   GO:0015031   GO:0001701   GO:0051290   GO:1904395   GO:0097060   GO:1901631   GO:0051124   GO:0042733   GO:0009953   GO:0050808   GO:0001822   GO:0048813   GO:0016055   GO:0071340   GO:0001942   GO:0097104   GO:0014069   GO:0097110   GO:0090090   GO:0042475   GO:0030279   GO:0050731   GO:0097105   GO:0031594   GO:0030971   GO:0009954   GO:0030509   GO:0050771   GO:0042803   GO:0044853   GO:0060173   GO:0008104   GO:0048856   GO:0030326   GO:0043113   GO:0001932   GO:0060284   GO:0050680   GO:0051091   GO:0030917   GO:0051593   GO:0045893   GO:0060444   GO:0048699   GO:0001756   GO:0014033   GO:0060070   GO:1990909   GO:0021915   GO:2000149   GO:0019210   GO:0001702   GO:0014029   GO:0021795   GO:0009952   GO:0061310   GO:0003401   GO:2000164   GO:0006355   GO:0060042   GO:2000051   GO:0021794   GO:0021872   GO:0090244   GO:0048705   GO:0002053   GO:0021861   GO:0046849   GO:0035115   GO:0036342   GO:0045599   GO:0042127   GO:0031410   GO:0009880   GO:0045780   GO:2000168   GO:0001947   GO:0007268   GO:0090118   GO:0060349   GO:0060325   GO:0003344   GO:0098609   GO:0110135   GO:0045778   GO:0034392   GO:0060021   GO:0061324   GO:0035261   GO:0060026   GO:0071397   GO:0009950   GO:0045202   GO:0071542   GO:0090245   GO:1990851   GO:0042813   GO:0021587   GO:0019534   GO:2000162   GO:2000166   GO:0035116   GO:0045944   GO:0060059   GO:0060603   GO:0021874   GO:0071936   GO:0043065   GO:0042802   GO:0048596   GO:0021943   GO:0001933   GO:0030901   GO:0060535   GO:0005102   GO:0060596   GO:0005901   GO:0005109   GO:0072659   GO:0045787   GO:2000151   GO:0090009   GO:0035108   GO:0071901   GO:0042074   GO:0006469   GO:0017147   GO:1904928   GO:1904886   GO:0031901   GO:0043434   GO:0005576   GO:0044335   GO:0044340   GO:1904948   GO:1904953   GO:0042981   GO:0008217   GO:1902262   GO:0060033   GO:0045840   GO:0061304   GO:0045669   GO:0035426   GO:0045600   GO:0045668   GO:0048539   GO:0060348   GO:0006007   GO:0061299   GO:0009314   GO:0042632   GO:0033690   GO:0035019   GO:0060764   GO:0060612   GO:0005739   GO:0002076   GO:0001944   GO:0008284   GO:0061178   GO:1901998   GO:0008196   GO:0048477   GO:0030135   GO:0030229   GO:0034361   GO:0000122   GO:0034189   GO:0006869   GO:0034447   GO:0045860   GO:0038025   GO:1900006   GO:0034436   GO:0021517   GO:0048306   GO:0038026   GO:0071456   GO:0034437   GO:0007399   GO:0007411   GO:0007613   GO:0032802   GO:0007165   GO:0042149   GO:0001666   GO:0071222   GO:0032869   GO:0009725   GO:0071347   GO:0032496   GO:0007584   GO:0030296   GO:0007166   GO:0030228   GO:0005770   GO:0034362   GO:0030299   GO:0010899   GO:0042159   GO:0070508   GO:0010898   GO:0071398   GO:0030169   GO:0050729   GO:0030301   GO:1903979   GO:0051246   GO:0007616   GO:0010629   GO:0097443   GO:0010867   GO:0071404   GO:0061889   GO:0090181   GO:0034381   GO:0048844   GO:0061771   GO:0034383   GO:0034384   GO:0051248   GO:0036477   GO:0015914   GO:1990666   GO:0010628   GO:0005623   GO:0055038   GO:1905907   GO:0036020   GO:0010008   GO:0034382   GO:0001618   GO:0030669   GO:0021541   GO:0061098   GO:0019894   GO:0032793   GO:0045088   GO:0006508   GO:0004888   GO:0061003   GO:0005875   GO:0019221   GO:0008035   GO:0071363   GO:0050804   GO:0021819   GO:0021766   GO:0047485   GO:0033762   GO:0032355   GO:0043627   GO:0005771   GO:2001137   GO:1901215   GO:0043407   GO:1902963   GO:1902960   GO:0030306   GO:1902948   GO:1902955   GO:0016477   GO:1902997   GO:1902430   GO:0032091   GO:1902953   GO:0014910   GO:0005641   GO:0055037   GO:0032460   GO:0006622   GO:0050768   GO:0006605   GO:0034067   GO:0005802   GO:0051604   GO:0045732   GO:0006892   GO:0031985   GO:0070863   GO:1902771   GO:1902966   GO:0045053   GO:0044267   GO:0000139   GO:0043388   GO:0008083   GO:0046425   GO:0030154   GO:0007155   GO:0004930   GO:0030414   GO:0062023   GO:0043394   GO:0005604   GO:0005518   GO:0043237   GO:0030198   GO:0031012   GO:0010811   GO:0007160   GO:0071944   GO:0043236   GO:0032836   GO:0050840   GO:0005201   GO:0071711   GO:0007275   GO:0030703   GO:0007338   GO:1904778   GO:0016486   GO:0015629   GO:0003050   GO:0035813   GO:0016604   GO:0004252   GO:1903779   GO:0007565   GO:0030021   GO:0009888   GO:0034446   GO:0043202   GO:0006954   GO:0006027   GO:0008022   GO:0007420   GO:0006024   GO:0005178   GO:0009887   GO:0072358   GO:0016525   GO:0001525   GO:0005796   GO:0008236   GO:0060672   GO:0030216   GO:0019897   GO:0070268   GO:0002062   GO:0048738   GO:0001958   GO:0060351   GO:0048704   GO:0031175   GO:0001764   GO:0070613   GO:0008592   GO:0045087   GO:0045752   GO:0050830   GO:0050832   GO:0040008   GO:0030182   GO:0070858   GO:0030659   GO:0007306   GO:0016540   GO:0031638   GO:0098595   GO:0016485   GO:0007313   GO:0007343   GO:0005515   GO:0003824   GO:0009982   GO:0006744   GO:0016627   GO:0030145   GO:0015923   GO:0006260  

PANTHER

PTHR24270:SF16   PTHR11339:SF358   PTHR24258:SF133  

Subcellular location

Apical cell membrane   Localizes to brush border membranes in the kidney (PubMed:6752952, PubMed:12724130). In the endolymphatic sac of the inner ear, located in the lumen of endosomes as a soluble form (PubMed:17063000).   With evidence from 12 publications.
Endosome lumen   Localizes to brush border membranes in the kidney (PubMed:6752952, PubMed:12724130). In the endolymphatic sac of the inner ear, located in the lumen of endosomes as a soluble form (PubMed:17063000).   With evidence from 12 publications.
Membrane   Localizes to brush border membranes in the kidney (PubMed:6752952, PubMed:12724130). In the endolymphatic sac of the inner ear, located in the lumen of endosomes as a soluble form (PubMed:17063000).   With evidence from 12 publications.
Clathrin-coated pit   Localizes to brush border membranes in the kidney (PubMed:6752952, PubMed:12724130). In the endolymphatic sac of the inner ear, located in the lumen of endosomes as a soluble form (PubMed:17063000).   With evidence from 12 publications.
Cell projection   Localizes to brush border membranes in the kidney (PubMed:6752952, PubMed:12724130). In the endolymphatic sac of the inner ear, located in the lumen of endosomes as a soluble form (PubMed:17063000).   With evidence from 12 publications.
Dendrite   Localizes to brush border membranes in the kidney (PubMed:6752952, PubMed:12724130). In the endolymphatic sac of the inner ear, located in the lumen of endosomes as a soluble form (PubMed:17063000).   With evidence from 12 publications.
Axon   Localizes to brush border membranes in the kidney (PubMed:6752952, PubMed:12724130). In the endolymphatic sac of the inner ear, located in the lumen of endosomes as a soluble form (PubMed:17063000).   With evidence from 12 publications.
Coated pit   Localizes to brush border membranes in the kidney. In the endolymphatic sac of the inner ear, located in the lumen of endosomes as a soluble form.   With evidence from 3 publications.
Cell membrane  
Cytoplasm   After cleavage, the intracellular domain (LRPICD) is detected both in the cytoplasm and in the nucleus.   With evidence from 3 publications.
Nucleus   After cleavage, the intracellular domain (LRPICD) is detected both in the cytoplasm and in the nucleus.   With evidence from 3 publications.
Endoplasmic reticulum   On Wnt signaling, undergoes a cycle of caveolin- or clathrin-mediated endocytosis and plasma membrane location. Released from the endoplasmic reticulum on palmitoylation. Mono-ubiquitination retains it in the endoplasmic reticulum in the absence of palmitoylation. On Wnt signaling, phosphorylated, aggregates and colocalizes with AXIN1 and GSK3B at the plasma membrane in LRP6-signalsomes (By similarity). Chaperoned to the plasma membrane by MESD.   With evidence from 1 publications.
Membrane raft   On Wnt signaling, undergoes a cycle of caveolin- or clathrin-mediated endocytosis and plasma membrane location. Released from the endoplasmic reticulum on palmitoylation. Mono-ubiquitination retains it in the endoplasmic reticulum in the absence of palmitoylation. On Wnt signaling, phosphorylated, aggregates and colocalizes with AXIN1 and GSK3B at the plasma membrane in LRP6-signalsomes (By similarity). Chaperoned to the plasma membrane by MESD.   With evidence from 1 publications.
Golgi apparatus   Rapidly endocytosed upon ligand binding.   With evidence from 2 publications.
Early endosome   Rapidly endocytosed upon ligand binding.   With evidence from 2 publications.
Late endosome   Rapidly endocytosed upon ligand binding.   With evidence from 2 publications.
Lysosome   Rapidly endocytosed upon ligand binding.   With evidence from 2 publications.
Secreted   Isoforms that contain the exon coding for a furin-type cleavage site are proteolytically processed, leading to a secreted receptor fragment.   With evidence from 3 publications.
Endosome  
  
Cytoplasmic vesicle  
Cytoplasmic vesicle membrane  

Length:

4546

Number of predicted TMHs:

1

Exp number of AAs in TMHs:

22.9103

Exp number, first 60 AAs:

0

Total prob of N-in:

0.00034

outside

1  -  4384

TMhelix

4385  -  4407

inside

4408  -  4546

 

 

Pi

213.466994

Theta

203.165756

Tajima's D

0.48269

CLR

0.366302

CSRT

0.502274886255687

Interpretation

Uncertain