SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06351
Annotation
T18197_reverse_transcriptase-like_protein_-_silkworm
Full name
Retrovirus-related Pol polyprotein from type-1 retrotransposable element R2       + More
Retrovirus-related Pol polyprotein from type-2 retrotransposable element R2DM      
Alternative Name
Retrovirus-related Pol polyprotein from type I retrotransposable element R2
Retrovirus-related Pol polyprotein from type II retrotransposable element R2DM
Location in the cell
Mitochondrial   Reliability : 1.954
 

Sequence

CDS
ATGGATGCCGCTTCGGTGATGGTGAAGCGGTGGTGGCATGGCGAGGAAGTCGACCTCCTCGCTCGCACCGAGGCCAGGTCCCTCGCTGAGCGGGGTCAGTGCTCTGGTGGAGACCTTTTTGGCGCGATCTCAGTGGAAGAGATCAAGGCTTCCCGCTTTGACTGGCGGACTTCACCGGGCCCGTATGGTATACGTCAGGGTCAGTGGCGTGCAGTTCCTGTGCACCTGAAGACGGAAATGTTCAATGCTTGGATGGCACAAGGCGAAATACCTGAAATTCTACGGCAGTACCGAATCGTCTTTGTGCCTAAGGTGGAGAGACCAGGTGGACTGGGGGAATATCGACCGATTTCGATCGCGTCTATACCTCTGAGACACTTTCACTCCATCTTGGCCCAGAGGTTGTTGGCTTGCTGCCCCCCTAATGCACGACAGCGTGGATTTATCTGCGCCGACGGTACTTTGGAAAATTCCGCAGTACTGGACGCAGTGCTTGGGGATAGCAGGAGGAAGCTGCGGGAATGTCACGTGGCGGTGCTAGACTTCGTCAAGGCATTCGACACTGTGTCTCACGAAGCACTTGTGGGATTGCTAAGGTCGAGGGGCATGCCCGAACAGTTCTGCGGCTATATTGCTCATCTGTACGATACGGCGTCCACCACCTTAGCCGTTAATAATGTGATGAGCAACCCTGTGAAAGTGGGACGAGGGGTTCGTCAAGGGGACCCTCTGTCGCCAATACTGTTCAACGTGGTGATGGACCTCATCCTAGCTTCCCTGCCGGAGAGGGTCGGGTATAGGTTGGAGATGGAACTTGTGTCCGCTTTGGCTTATGCTGACGACCTAGTCCTGCTTGCGGGGTCAAAGGTAGGGATGCAGAAGTCCATCTCTGCTGTGGACTGTGTTGGTTGGCAGATGGGCCTTCGCCTGAACAGCAGGAAAAGCGCGGTCCTGTCAATGATACTAGATGGCCACCGTAAGAAGCACTATTACCTGACTAAGCGAACCTTCAACATTGGAGATAAGCCGCTCAGGCAGGTGAGTTGTGTCGAGCGGAGGCGATATACTGGTGTTGACTTTGAGCCCTCTGGATGCGTGACGTTAGAGCATAGCATCAGTAATGCTTTGAATGACGTGACAAGGGCACCTCTCAAACCCTAA
Protein
MDAASVMVKRWWHGEEVDLLARTEARSLAERGQCSGGDLFGAISVEEIKASRFDWRTSPGPYGIRQGQWRAVPVHLKTEMFNAWMAQGEIPEILRQYRIVFVPKVERPGGLGEYRPISIASIPLRHFHSILAQRLLACCPPNARQRGFICADGTLENSAVLDAVLGDSRRKLRECHVAVLDFVKAFDTVSHEALVGLLRSRGMPEQFCGYIAHLYDTASTTLAVNNVMSNPVKVGRGVRQGDPLSPILFNVVMDLILASLPERVGYRLEMELVSALAYADDLVLLAGSKVGMQKSISAVDCVGWQMGLRLNSRKSAVLSMILDGHRKKHYYLTKRTFNIGDKPLRQVSCVERRRYTGVDFEPSGCVTLEHSISNALNDVTRAPLKP

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Keywords
Complete proteome   Endonuclease   Hydrolase   Metal-binding   Nuclease   Nucleotidyltransferase   Reference proteome   RNA-directed DNA polymerase   Transferase   Transposable element   Zinc   Zinc-finger   Aspartyl protease   Protease  
Feature
chain  Retrovirus-related Pol polyprotein from type-1 retrotransposable element R2
EMBL
M16558    AAB59214.1    AB076841    BAC01114.1    AF436853    AAQ04479.1    + More
GBBI01004849    JAC13863.1    LBMM01006940    KMQ90176.1    GBYB01008309    JAG78076.1    GBBI01004906    JAC13806.1    GBBI01004905    JAC13807.1    LBMM01007077    KMQ90064.1    L00950    AAZX01002322    AAZX01010802    AAZX01015897    GGMS01004512    MBY73715.1    GFWV01007503    MAA32233.1    GFWV01012635    MAA37364.1    KQ971997    KYB24671.1    JQ082370    AFM44926.1    GFAC01003453    JAT95735.1    GFTR01008394    JAW08032.1    LBMM01007118    KMQ90015.1    UFQS01003262    UFQT01003262    SSX15424.1    SSX34793.1    X51967    FJ461304    ACJ71597.1    GACK01007407    JAA57627.1    GBRD01016678    JAG49149.1    GBHO01045037    GBHO01045036    JAF98566.1    JAF98567.1    GFAC01005869    JAT93319.1    KJ958674    AIL01110.1    GDHC01017848    JAQ00781.1    GFWV01002964    MAA27694.1    AB097121    BAC82589.1    LBMM01009160    KMQ88341.1    GEDV01005279    JAP83278.1    GFWV01001114    MAA25844.1    AAZX01023288    AAZX01023287    AF015815    AAC34903.1    KK855758    PTY23787.1    AF015819    AAC34906.1    AF015685    AAB94032.1    AB097122    BAC82590.1    ABLF02003433    L00951    JN937619    AFO19998.1    JN937617    AFO19996.1    UFQS01005448    UFQT01005448    SSX16818.1    SSX35999.1    EU854578    ACJ46647.1    KMQ88340.1    GBRD01002048    JAG63773.1    UZAL01048126    VDP85427.1    GFWV01017530    MAA42258.1    GFAC01000014    JAT99174.1    AAZX01010801    AAZX01015898    GFJQ02001120    JAW05850.1    AAZX01010936    KK855289    PTY21830.1    AAZX01024756    AAZX01024918    AB097123    BAC82591.1    KZ442244    PIS78050.1    UZAI01021487    VDP55649.1    JN937618    AFO19997.1    GFJQ02003336    JAW03634.1    ABLF02008889    GEDV01003881    JAP84676.1    ABJB010154799    ABJB010360364    DS776301    EEC09393.1    AJVK01035490    LC155026    BAX24488.1   
Pfam
PF00078   RVT_1        + More
PF00096   zf-C2H2
Interpro
IPR013087   Znf_C2H2_type        + More
IPR000477   RT_dom       
IPR036236   Znf_C2H2_sf       
IPR001005   SANT/Myb       
SUPFAM
SSF57667   SSF57667       
PDB
6AR3     E-value=0.0132027,     Score=90

Ontologies

Topology

Length:
386
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0336500000000001
Exp number, first 60 AAs:
0
Total prob of N-in:
0.02741
outside
1  -  386
 
 

Population Genetic Test Statistics

Pi
0.685705
Theta
1.190988
Tajima's D
-0.895382
CLR
23.117561
CSRT
0.167791610419479
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号