SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06348
Annotation
endonuclease_and_reverse_transcriptase-like_protein_[Bombyx_mori]
Location in the cell
PlasmaMembrane   Reliability : 1.663
 

Sequence

CDS
ATGGAGCGAATAATAAATATTCAACTCCTGAAGTATCTTGAGGATCGCCAGCTGATCAGTGACCGACAGTACGGCTTCCGTCACGGTCGCTCAGCTGGCGATCTTCTTGTATACCTTACTCACAGGTGGGCTGAAGCCTTGGAGAGCAAGGGCGAGGCTCTTGCTGTGAGCCTTGATATCGCGAAGGCCTTCGACAGGGTCTGGCATAGGGCACTTCTGTCGAAGCTACCATCTTACGGAATCCCCGAGGGTCTCTGCAAGTGGATCGCTAGATTTTTGGATGGGCGGAGCATCACGGTCGTTGTAGACGGTGACTGTTCTGATACCATGACCATTAACGCTGGCGTTCCACAAGGTTCGGTGCTCTCCCCCACGCTTTTCATCCTGTATATCAATGACATGCTGTCTATTGATGGCATGCATTGCTATGCGGATGACAGCACGGGGGATGCGCGATATATCGGCCATCAGAGTCTCTCTTGGAGCGTGGTGCAAGAGAGACGATCAAAACTTGTGTCTAAAGTGGAGAACTCTCTGGGGCGAGTCTCCAAATGGGGTGAATTGAACTTGGTTCAATTCAACCCGTTAAAGACACAAGTTTGCGCGTTCACTGCCAAGAAGGACCCCTTTGTCATGGCGCCACAATTCCAAGGAATATCCCTGCAACCTTCCAAGAGTATCGGGATACTTGGGGTCGACATTTCGAACGACGTCCAGTTTCGGAGTCATTTGGAAGGCAAAGCCAAGTTGGCGTCCAAAATGCTGGGAGTCCTCAACAGAGCGAAGCGGTACTTCACGCCTGGAGCCAAAGGCTTTTGCTTTATAAAGCACAAGTCCGGCCTCGCGTGGAGTACTGCTCCCATCTCTGGGCCGGGGCTCCCAAATACTAGCTTCTTCCATTTGACTCCCTACAGAAGAGGGCCGTTCGGATTGTCGATAATCCCATTCTCTCGGATCGTTTGGAACCTCTGGGTCTGCGGAGGGACTTCGGTTCCCTCTGTATTTTGTACCGTATGTTCCATGGGGAGTGCTCTGAGGATTTATTCGAGATGA
Protein
MERIINIQLLKYLEDRQLISDRQYGFRHGRSAGDLLVYLTHRWAEALESKGEALAVSLDIAKAFDRVWHRALLSKLPSYGIPEGLCKWIARFLDGRSITVVVDGDCSDTMTINAGVPQGSVLSPTLFILYINDMLSIDGMHCYADDSTGDARYIGHQSLSWSVVQERRSKLVSKVENSLGRVSKWGELNLVQFNPLKTQVCAFTAKKDPFVMAPQFQGISLQPSKSIGILGVDISNDVQFRSHLEGKAKLASKMLGVLNRAKRYFTPGAKGFCFIKHKSGLAWSTAPISGPGLPNTSFFHLTPYRRGPFGLSIIPFSRIVWNLWVCGGTSVPSVFCTVCSMGSALRIYSR

Summary

Cofactor
pyridoxal 5'-phosphate
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF00282   Pyridoxal_deC
PF04939   RRS1
PF03081   Exo70
PF01585   G-patch
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR015424   PyrdxlP-dep_Trfase       
IPR002129   PyrdxlP-dep_de-COase       
IPR021115   Pyridoxal-P_BS       
IPR015421   PyrdxlP-dep_Trfase_major       
IPR015422   PyrdxlP-dep_Trfase_dom1       
IPR010977   Aromatic_deC       
IPR007023   Ribosom_reg       
IPR016159   Cullin_repeat-like_dom_sf       
IPR004140   Exo70       
IPR012677   Nucleotide-bd_a/b_plait_sf       
IPR000504   RRM_dom       
IPR034653   SPF45_RRM       
IPR003954   RRM_dom_euk       
IPR000467   G_patch_dom       
IPR040052   RBM17       
IPR035979   RBD_domain_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF53383   SSF53383       
SSF74788   SSF74788       
SSF54928   SSF54928       
PDB
6AR3     E-value=2.43759e-05,     Score=113

Ontologies

Topology

Length:
350
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
10.08303
Exp number, first 60 AAs:
0
Total prob of N-in:
0.02020
outside
1  -  350
 
 

Population Genetic Test Statistics

Pi
146.298294
Theta
53.330367
Tajima's D
2.574622
CLR
0.720598
CSRT
0.952352382380881
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号