SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06320
Pre Gene Modal
BGIBMGA011165
Annotation
PREDICTED:_uncharacterized_protein_LOC105391048_[Plutella_xylostella]
Full name
Galactose-1-phosphate uridylyltransferase      
Location in the cell
Mitochondrial   Reliability : 1.552 Nuclear   Reliability : 2.1
 

Sequence

CDS
ATGTCTCAAGAAATCTACAGAGTTGGTGTGCGCATTCCGCCATTCTGCTCAGAGGACCCAGAAATGTGGTTTAGTCAGATAGAGATGCAATTTAAGCTCTCAGGGATATCGGTGGACGATACTAAGTTTACGTATGTGTCAGCGAACCTGGAACCACAATACGCCAAGGAGGTGAGAGACATCATAACGAAACCGCCAGCTTCAAATAAATACGAGAAACTCAAAACAGAGCTGATCAAGCGACTATCAATATCACAGGAGAAGCGAGTAAGACAACTCCTCATGCACGAAGAACTCGGAGATCGGAAACCGTCTCAGTTTCTACGCCACTTGACAAGTCTAGCTGGTTCAGACGTTCCATCTGATTTTATAATAACCATCTGGACCAGTCGTCTGCCTGTGAACGTGCAAACAGCAGTCGCTACGATTAAAGGATCGTCAATGGAGAAGCTGAGTGACTTGGCAGATGTCGTATATGAAATGGCCCCAACAGTACCACAGGTAGCAAGCGCGTCTTCCCAAGCCCAAGGCAATGAGCAAGGCAATCCGACGATGATTGAGATGGCCCAGCAAATCAATTCACTGACACAACAAATCAGCTTGCTCTCTAAGCAGTTTCGCGTCGGAAAACTCCTGGGGCGGTCGGAAGTAGCGGCCAACGACTGCCCACATTCTTCAGGCCGTCTTTTTATCACCGATCGTACTTCAAAAATGCAGTTCCTATTGGACACTGGTTCCGATCTGTGTGTTTTTCCACGGTCGGCTGTGAAGGCGCCCTGTACCAAGTCGAAATATGATCTCGTAGCCGCGAATAATTCTATTATACACACCTATGGCCCTGTAACTCTTCATTTAGACTTTGGACTAAGAAGAGACTTCGCGTGGAAATTCACTGTTGCAGACGTTTCTAAGCCCATAATCGGAGTGGATTTCTTGTCTTACTACAACTTACTCGTCGATTGCAGAAAACAGCGTATCATTGATGGCATCACTTCTCTGTCTGCAGTCGCGACACCTATCGGGATGACTAAAGACCTTCCTTCTGTCAAAGCCGTCACTGGAGAAACTGACTTCCACGATATTCTGAGAGAGTTCCCAGAAATCACAAGGCCAGCAGGTATGCTCTGTACCACATTTAAGCATAACACCGTCCATCATATCAGAACTACACCGGGACCTCCAGTTGCTTGCAAGCCTCGACGTTTAGATCCAGCACGCATGCAAGCCGCGAAGAAAGAGTTCGAGGATATGTTGGCAAGCGGCGTAGCCCGGCGTTCAGAGAGTGCATGGTCTTCTGCTCTGCACTTGGTGAAGAAGAAAGATGACGGATGGCGTCCTTGTGGCGATTACCGATCACTGAATGCGAGGACGATACCTGATAGGTATCCAGTACGCCACATCCACGATTTCTCACAACAACTTTCTGGATGTTCCATCTTTTCTAAAATTGATTTGGTGAAGGCTTATCATCAGATAGCCGTTAATCCTGAGGATATACCGAAAACAGCCATCACTACTCCTTTTGGACTTTACGAATTTCCATTTATGACCTTTGGTTTGAGGAATGCCGCTCAGACATTCCAAAGGTTCATAGATGAGGTGCTACTAGGCCTCGACTTCACCTACGGATATATTGATGATATATTATTGTTTTCTTCATCGCTAGAAGAACATAAGCGTCATCTACGTCAACTCTTTGATCGTCTCCGGCAGTATGGCATTCTGGTGAACACAACAAAATGTACTTTTGGTCAATCGGTCGTGGAATTCCTAGGATATGAAGTATCTGCTACAGGTACTAAACCATTGGACACTAAAGTCCAAGCTATCCAGGAATTTGCTGCTCCCAAGACTGTGAAAGAACTCCGAAGATTCTTAGGCATGCTTAATTTCTACCGCCGTTTCATACCTAATGCCGCCCAGTTACAAGCTCCGTTGAACAACGCTCTGGCAGGAGTTAAAATGAAAGGTTCACATCCTGTGGATATGGATGCAGCCATGTTAAAAGCTTTTGAGGACTGTAAGACTTCTTTATCCCAGGCAACGCTTTTGTCTCACCCGGATCCAACCGCCGATCTTGCTATTGTCACTGACGCGTCTCTCACAGCGATCGGAGCTGTTCTACAACAAAGGAGAGGTGAACATTGGGAACCACTCGCTTTCTACTCCCACAAGCTTAGTTCCACCCAATCGAAGTACAGTCCATATGATCGAGAATTACTGTCAGTTTATGAGGCAATAAAGCATTTTCGACACATGATCGAAGCGAGAAATTTCACTGTCTTCACTGATCATAAACCGCTGACTTTTGCCTTCTCAGTAAACAGGGAGAAATGTTCACCAAGGCAATTCAGATATCTCGACTACATATCACAGTTTACTACGGATATTAAATATATACCTGGAAAGGATAACGTAGTCGCCGACGCACTTTCTCGGGTGGATGAAGTCGCTCCATGTATCGACTATGAGCATCTTGCACGATCTCAGGAACAAGATCCAGAGCTGCAAGATCTTCTGCGTAATGGAAGTTCCCTGAAATTAGAAAAGTTATCTTCCGAGTATAGTAGCTTACCCGTTTATTGCGACACCAGTGTGCACCCTCCACGACCATTCATCACAAAAGATATGCGAAGACAAGTCTTCAACACACTGCATGGACTTCACCACCCAGGATCGTCAGCTACAGTCCGACTGGTTGCGCAAAGATTTGTGTGGCCAGGGATTCGGAAAGACTGTAGAGAGTGGTCAAGACAATGCTTAAACTGTCAGAGAAGTAAAGTCACTCGCCATACAGTTTCTCCTCTTTCCTCTTTCCTTACTCCTTCGTCAAGATTCACTCATATCCATCTTGACATCGTAGGGCCTCTAAATCTGTCTGCTGGTTTCAGGTACTGCCTCACTGTCATTGACCGCTTTACCCGATGGCCTGAGGTGATACCACTCAGCGAAATTACAGCTGAAGCTTGTGCTGCCGCCCTCGTTACCGGCTGGATTACCAGATTTGGATGTCCACTGCGGGTAACTACCGACCGTGGTCGTCAATTCGAGAGCCACTTATTCAAAGCCATAGCTGCATTAATAGGTGCTCACCACTTCCGGACTACCGCATATCACCCCGCCGCCAACGGAATAGTCGAACGAATGCATCGCCAGTTGAAGGCAGCCATCATGTGCCATACATCTTCGCAATGGACTGAAGCACTTCCTCTCGTACTGATGGGCATGCGCAGTTCCTGGAAAGATGACATTGCCGCATCCCCTGCAGAGCTGGTGTACGGCGAGCCCCTCTGTCTGCCAGGTCAATTCATTTCACCAAATGAAGACTACAAAGTGTCTGACGTCACCCAGTATGCAACTCGTCTACGTGCATGCATGGCGAATTTGACACCGAGACCGACATCCTGGCATAGCAATTCACCATTTTATATACCTCGCGATTTACATACAACCTCCCATGTCTTCATCCGACAAGATCATGTGCGTGGTTCTCTGGTACCACCATATGCTGGTCCCTTTAAGGTTGTCAAAAGGCAGCCAAAATTCTTCACTGTCGAAGTTCGAGGGAAGCTTGTAAATGTCTCCATAGATCGTCTGAAGCCGGCCTACATGACGAGAGTTCCAGAAGGTGTGTCTCCAACCAAGCCTGTTGAAAAAACTACAAGAAGCGGCCGAAAGATTAAACTGCCCGATTACTATCGACCGTAG
Protein
MSQEIYRVGVRIPPFCSEDPEMWFSQIEMQFKLSGISVDDTKFTYVSANLEPQYAKEVRDIITKPPASNKYEKLKTELIKRLSISQEKRVRQLLMHEELGDRKPSQFLRHLTSLAGSDVPSDFIITIWTSRLPVNVQTAVATIKGSSMEKLSDLADVVYEMAPTVPQVASASSQAQGNEQGNPTMIEMAQQINSLTQQISLLSKQFRVGKLLGRSEVAANDCPHSSGRLFITDRTSKMQFLLDTGSDLCVFPRSAVKAPCTKSKYDLVAANNSIIHTYGPVTLHLDFGLRRDFAWKFTVADVSKPIIGVDFLSYYNLLVDCRKQRIIDGITSLSAVATPIGMTKDLPSVKAVTGETDFHDILREFPEITRPAGMLCTTFKHNTVHHIRTTPGPPVACKPRRLDPARMQAAKKEFEDMLASGVARRSESAWSSALHLVKKKDDGWRPCGDYRSLNARTIPDRYPVRHIHDFSQQLSGCSIFSKIDLVKAYHQIAVNPEDIPKTAITTPFGLYEFPFMTFGLRNAAQTFQRFIDEVLLGLDFTYGYIDDILLFSSSLEEHKRHLRQLFDRLRQYGILVNTTKCTFGQSVVEFLGYEVSATGTKPLDTKVQAIQEFAAPKTVKELRRFLGMLNFYRRFIPNAAQLQAPLNNALAGVKMKGSHPVDMDAAMLKAFEDCKTSLSQATLLSHPDPTADLAIVTDASLTAIGAVLQQRRGEHWEPLAFYSHKLSSTQSKYSPYDRELLSVYEAIKHFRHMIEARNFTVFTDHKPLTFAFSVNREKCSPRQFRYLDYISQFTTDIKYIPGKDNVVADALSRVDEVAPCIDYEHLARSQEQDPELQDLLRNGSSLKLEKLSSEYSSLPVYCDTSVHPPRPFITKDMRRQVFNTLHGLHHPGSSATVRLVAQRFVWPGIRKDCREWSRQCLNCQRSKVTRHTVSPLSSFLTPSSRFTHIHLDIVGPLNLSAGFRYCLTVIDRFTRWPEVIPLSEITAEACAAALVTGWITRFGCPLRVTTDRGRQFESHLFKAIAALIGAHHFRTTAYHPAANGIVERMHRQLKAAIMCHTSSQWTEALPLVLMGMRSSWKDDIAASPAELVYGEPLCLPGQFISPNEDYKVSDVTQYATRLRACMANLTPRPTSWHSNSPFYIPRDLHTTSHVFIRQDHVRGSLVPPYAGPFKVVKRQPKFFTVEVRGKLVNVSIDRLKPAYMTRVPEGVSPTKPVEKTTRSGRKIKLPDYYRP

Summary

Catalytic Activity
alpha-D-galactose 1-phosphate + UDP-alpha-D-glucose = alpha-D-glucose 1-phosphate + UDP-alpha-D-galactose
Similarity
Belongs to the galactose-1-phosphate uridylyltransferase type 1 family.
Belongs to the histone H3 family.
EC Number
2.7.7.12
EMBL
LBMM01012479    KMQ86204.1    LBMM01013040    KMQ85849.1    LBMM01009142    KMQ88359.1    + More
GBXI01015889    JAC98402.1    LBMM01013103    KMQ85815.1    LBMM01001181    KMQ96765.1    AAGJ04130731    KQ971355    EFA07205.2    KL363241    KFD51254.1    AAGJ04001742    ABLF02030693    ABLF02030697    AAGJ04112098    AY013563    AAK07485.1    DF142933    GAA49140.1    AAGJ04172791    AY013569    AAK07487.1    GBXI01003773    JAD10519.1    LBMM01012567    KMQ86146.1    AY013565    AAK07486.1    GBXI01017046    JAC97245.1    LBMM01012160    KMQ86374.1    GFDL01003994    JAV31051.1    EF426679    ABP48077.1    AAGJ04000250    FN356213    CAX83702.1    GEGO01003687    JAR91717.1    LBMM01012134    KMQ86388.1    KL367778    KFD59660.1    KL367543    KFD65158.1    GGFK01003401    MBW36722.1    GGFK01003442    MBW36763.1    KL367544    KFD65142.1    GGLE01001814    MBY05940.1    LN877232    CTR11708.1    AAGJ04164195    AAGJ04164196    AAGJ04164197    GEGO01001281    JAR94123.1    GEGO01000286    JAR95118.1    BK004066    DAA04495.1    KL367552    KFD64647.1    ABLF02040931    ABLF02040938    KQ973093    EFA13472.2    JWZT01003175    KII67485.1    JWZT01002058    KII70465.1    JWZT01001363    KII72172.1    ABLF02058233    JWZT01004124    KII64665.1    JWZT01005177    JWZT01001778    KII61927.1    KII71382.1    CABG01000050    CAZ37786.2    BK004070    DAA04500.1    GEGO01003506    JAR91898.1    GDHF01001116    JAI51198.1    KL367655    KFD60653.1    GDHF01014424    JAI37890.1    GDHF01021808    JAI30506.1    KL363373    KFD46409.1    MRZV01001828    PIK35719.1    GEGO01004649    JAR90755.1    GEGO01004484    JAR90920.1    BN000802    CAJ00250.1    GEDV01001796    JAP86761.1    KL367492    KFD69854.1    ABLF02005645    ABLF02042063    GDKW01003376    JAI53219.1    GGLE01003443    MBY07569.1    AAZX01013940    KL367479    KFD72009.1    JYDR01000002    KRY79251.1    LBMM01012633    KMQ86092.1    GACK01008900    JAA56134.1    GEGO01004686    JAR90718.1    KL367564    KFD63933.1    ABLF02006352    ABLF02013150    ABLF02013854    ABLF02041505    AAZX01006801    AAZX01023483    GFPF01012375    MAA23521.1    GEGO01004475    JAR90929.1    KL363454    KFD45607.1    JYDJ01000353    KRX36608.1    JYDT01000067    KRY86703.1    AAZX01023279    KL363200    KFD55401.1    ABLF02057446    ABLF02059301    AAZX01009606    KL363318    KFD47658.1    KL367664    KFD60497.1    AAZX01023264    FN356212    CAX83701.1    NIVC01003188    PAA52757.1    JYDV01000002    KRZ45603.1    ABLF02011086    ABLF02042879    AAZX01004786    ABLF02007585    QPMK01000035    RDD64024.1   
Pfam
PF17921   Integrase_H2C2        + More
PF17919   RT_RNaseH_2
PF00078   RVT_1
PF00665   rve
PF01087   GalP_UDP_transf
PF17917   RT_RNaseH
PF00176   SNF2_N
PF00271   Helicase_C
PF05918   API5
PF13359   DDE_Tnp_4
PF00125   Histone
PF16211   Histone_H2A_C
PF00077   RVP
Interpro
IPR012337   RNaseH-like_sf        + More
IPR001995   Peptidase_A2_cat       
IPR041577   RT_RNaseH_2       
IPR001584   Integrase_cat-core       
IPR036397   RNaseH_sf       
IPR041588   Integrase_H2C2       
IPR000477   RT_dom       
IPR021109   Peptidase_aspartic_dom_sf       
IPR001969   Aspartic_peptidase_AS       
IPR034132   RP_Saci-like       
IPR005849   GalP_Utransf_N       
IPR019779   GalP_UDPtransf1_His-AS       
IPR001937   GalP_UDPtransf1       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR036265   HIT-like_sf       
IPR041373   RT_RNaseH       
IPR013032   EGF-like_CS       
IPR016024   ARM-type_fold       
IPR014001   Helicase_ATP-bd       
IPR001650   Helicase_C       
IPR008383   API5       
IPR038718   SNF2-like_sf       
IPR027417   P-loop_NTPase       
IPR000330   SNF2_N       
IPR027806   HARBI1_dom       
IPR000164   Histone_H3/CENP-A       
IPR002119   Histone_H2A       
IPR032454   Histone_H2A_C       
IPR007125   Histone_H2A/H2B/H3       
IPR009072   Histone-fold       
IPR018061   Retropepsins       
SUPFAM
SSF50630   SSF50630        + More
SSF53098   SSF53098       
SSF54197   SSF54197       
SSF56219   SSF56219       
SSF52540   SSF52540       
SSF48371   SSF48371       
SSF47113   SSF47113       
PDB
4OL8     E-value=2.90004e-66,     Score=644

Ontologies

Topology

Subcellular location
Chromosome  
Nucleus  
Length:
1235
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0292699999999999
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00046
outside
1  -  1235
 
 

Population Genetic Test Statistics

Pi
102.594218
Theta
42.348999
Tajima's D
2.871204
CLR
0.43439
CSRT
0.972601369931503
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号