SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06309
Annotation
T18197_reverse_transcriptase-like_protein_-_silkworm
Location in the cell
Nuclear   Reliability : 2.134
 

Sequence

CDS
ATGATGGTGAAGCGGCGGTGGCATGGCGAGGAAATCGACCTCCTCGCTCGCACCGAGGCCAGGTTGCTCGCTGAGCGGGTCAGTGCTCGGGTGGAGACCTCTTTGGCGCGCTTCCAGGGTTTGGAAGAACTCTGGAAGCGATTAAGGACAACGGCGGAGGGAGCCTTATCGGGCATTGGTGCAAGCGCACCTTGCCGATTTGGTTCCCAGCCGGGTCCCTCGTCAGGGGGGTGCTCGCCGAGCCTGACTTCCGGCGGGCTTCTGGAGCTGAGGAAGCGGGCGAGGAACGATGCGCCGAAGACGCCGCTGCCTATGATCCATCCGCAGTCGAGCAGAGTACGCGCGCGTGTGCAGGAACTGTACAAGAAGTGTCGCAGCAGAGCAGCAGCTGAGGTGATCGATGGCGCGTGTGGGGGTGTCGGACACTCGCGAGGAGATGGAGACCTATTGGCGACCTATCCTCGAGAGAGTGTCCGATGCACCTGGGCCTACACCGGAAGCTCTTCACGCCTAGGGCGTGCGGAGTTGCACGGGGGCAATCGCGACTACACCCAGCTGTGGAAGCCGATCTCGGTGGAAGAGATCAAGGCCTCCCGCTTTGACTGGCGAACTTCGCCGGGCCCGGACGGTATACGTTCGGACACTTTTCACTCCATCTTGGCCCGGAGGCTGTTGGCTTGCTGCCCCCCTGATGCACGACAGCGCGGATTTATCTGCGCCGACGGTACGCTGGAGAATTCCGCAGTACTGGACGCGGTGCTTGGGGATAGCAGGAAGAAGCTGCGGGAATGTCACGTGGCGGTGCTAGACTTCGCCAAGGCATTTGACACAGTGTCTCACGAGGCACTTGTCGAATTGCTGAGGTTGAGGGGCATGCCCGAACAGTTCTGCGGCTACATTGCTCACTTATACGATACGGCGTCCACCACCTTAGCCGTGAACAATGAAATGAGCAGCCCTGTGAAAGTGGGACGAGGGGTTCGTCAAGGGGACCCTCTGTCGCCGATACTCTTCAACGTGGTGATGGACCTCATCCTAGCTTCCCTGCCGGAGAGGGTCGGGTATAGGTTGGAGATGGAACTTGTGTCCGCTCTGGCCTATGCTGACGACCTAGTCCTGCTTGCGGGGTCGAAGGTAGGGATGCAGGAGTCCATCTCTGCTGTGGACTGTGTTGGTAAGCAGATGGGCCTACGCCTGAATTGCAGGAAGAGCGCGGTTCTGTCTATGATACCGGATGGCCACCGCAAGAAGCATCACTACCTGACTGAGCGAACCTTCAATATTGGAGGTAAGCCGCTCAGGCAGGTGAGTTGTGTTGAGCGGTGGCGATATCTTGGTGTCGATTTTGAGGCCTCTGGATGCGTGACATTAGAGCATAGTATCAGTAGTGCTCTGAATAACATCTCAAGGGCACCTCTCAAACCCCAACAGAGGTTGGAGATTTTGAGAGCTCATCTGATTCCGAGATTCCAGCACGGTTTTTGTGCTGACCGATTGAGAATGCTCGATGTCCAAATCCGGAAAGCAGTCGGACAGTGGCTAAGGCTACCGGCGGATGTGCCCAAGGCATACTATCACGCCGCAGTTCAGGACGGCGGCTTAGCGATCCCATCGGTGCGAGCGACCATCCCGGACCTCATTGTGAGGCGTTTCGGGGGCTCGACTCGTCACCATGGTCAGTGGCAAGAGCCGCCGCCAAATCTGATAAGATTCGTAAGAAACTGCGGTGGGCCTGGAAACAGCTCCGCAGGTTCAGCCGTGTTGACTCCACAACGCAACGACCATCTGTGCGCTTGTTTTGGCGAGAACATCTGCACGCATCTGTTGATGGACGCGAACTTCGCGAATCCACACGCACCCCGACATCCACAAAGTGGATTAGGGAGCGATGCGCGCAGATAA
Protein
MMVKRRWHGEEIDLLARTEARLLAERVSARVETSLARFQGLEELWKRLRTTAEGALSGIGASAPCRFGSQPGPSSGGCSPSLTSGGLLELRKRARNDAPKTPLPMIHPQSSRVRARVQELYKKCRSRAAAEVIDGACGGVGHSRGDGDLLATYPRESVRCTWAYTGSSSRLGRAELHGGNRDYTQLWKPISVEEIKASRFDWRTSPGPDGIRSDTFHSILARRLLACCPPDARQRGFICADGTLENSAVLDAVLGDSRKKLRECHVAVLDFAKAFDTVSHEALVELLRLRGMPEQFCGYIAHLYDTASTTLAVNNEMSSPVKVGRGVRQGDPLSPILFNVVMDLILASLPERVGYRLEMELVSALAYADDLVLLAGSKVGMQESISAVDCVGKQMGLRLNCRKSAVLSMIPDGHRKKHHYLTERTFNIGGKPLRQVSCVERWRYLGVDFEASGCVTLEHSISSALNNISRAPLKPQQRLEILRAHLIPRFQHGFCADRLRMLDVQIRKAVGQWLRLPADVPKAYYHAAVQDGGLAIPSVRATIPDLIVRRFGGSTRHHGQWQEPPPNLIRFVRNCGGPGNSSAGSAVLTPQRNDHLCACFGENICTHLLMDANFANPHAPRHPQSGLGSDARR

Summary

Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF02892   zf-BED
Interpro
IPR000477   RT_dom        + More
IPR013087   Znf_C2H2_type       
IPR036236   Znf_C2H2_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR003656   Znf_BED       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR001878   Znf_CCHC       
SUPFAM
SSF57667   SSF57667        + More
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
633
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00754999999999999
Exp number, first 60 AAs:
0.00016
Total prob of N-in:
0.00220
outside
1  -  633
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
453.566152
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号