SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06308
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.676 Nuclear   Reliability : 1.334
 

Sequence

CDS
ATGGGCCCGGCCACAGAGGGTTATACTGTTGCAAAAAAGTTTATTAAAGGAAATAGACCTGAAGCCTCTGGCCTCCCGCTGGAGTCAGAGAGGACAGGCGATAACCCGACTGTGCGGGGTTCCGCCGGCGCAGATCCTGTGGGTCAGGATGCGCCTGGTTGGACCTGCCAGTTCTGCGAACGATCCTTTTCGACCAACAGGGGTTTGGGTGTCCACAAGCGTAGAGCCCACCCTGTTGAGACTAATACGGATGCCGCTCCGATGATGGTGAAGCGGCGGTGGCATGGCGAGGAAGTCGACCTCCTCGCTCGCACCGAGGCCAGGTTGCTCGCTGAGCGGGGTCAGTGCTCGGGTGGAGACCTCTTTGGCGAGCTTCCAGGGTTTGGAAGAACTCTGGAAGCGATTAAGGGACAACGGCGGAGGGAGCCTTATCGGGAATTGGTGCAAGCGCACCTTGCCCGATCTGGTTCCCAGCCGGGTCCCTCGTCAGGGGGGTGCTCGGCCGAGCCTGACTTCCGGCGGGCTTCTGGAGCTGAGGAAGCGGGCGAGGAACGATGCGCCGAAGACGCCGCTGCCTATGATCCATCCGCAGTCGGTCAGATGTCGCCCGATGCCGCTCGGGTTCTCTCCGAACTCCTTGAGGGTGCGGGGAGAAGACGAGCGTGCAGGGCTATGAGACCCAAGACTGCAGGGCGGCGAAACGATTTGCACGATGATCGGACAGCTAGTGCCCACAAAACCAAAAGACAAAAGCGCAGAGCGGAGTACGCGCGTGTGCAGGAACTATACAAGAAGTGTCGCAGCAGAGCAGCAGCTGAAGTGATCGATGGCGCGTGTGGACCCCCAGTGTGGACGGTACTCTGGAGAATTCCGCAGTACTGGACGCGGTGCTTGGGGATAGCAGGAAGAAGCTGCGGGCGGGAATGTCACGTGGCGGTGCTAGACTTCGCTAAGGCATTCGACACTGTGTCTCACGAGGCACTTGTCGAATTGCTGAGGTTGAGGGGCATGCCCGTACAGTTCTGCGGCTACATTGCTCACCTATACGATACGGCGTCCACCACCTTAGCCGTGAACAATGAAATGAGCAGCCCTGTGAAAGTGGGACGAGGGGTTCGTCAAGGGGACCCTCTGTCGCCGATACTCTTCAACGTGGTGATGGACCTCATCCTGGCTTCCCTGCCGGAGAGGGTCGGGTATAGGTTGGAGATGGAACTCGTGTCCGCCCTGGCCTATGCTGACGACCTAGTCCTGCTTGCGGGGTCGAAGGTAGGGATGCAGGAGTCCATCTCTGCTGTGGACTGTGTCGGTAGGCAGATGGGCCTACGCCTGAATTGCAGGAAGAGCGCGGTTCTCTCTATGATACCGGATGGCCACCGCAAGAAGCATCACTACCTGACTGAGCGAACCTTCAATATTGGAGGTAAGCTGCTCAGGCAGGTGAGTTGTGTTGAGCGGTGGCGATATCTTGGTGTCGATTTTGAGGCCTCTGGATGCGTGACATTAGAGCATAGTATCAGTAGTGCTCTGAATAACATCTCAAGGGCACCTCTCAAACCCCAACAGAGGTTGGAGATTTTGAGAGCTCATCTGATTCCGAGGTTCCAGCACGGTTTCGTGCTTGGAAACATCTCGGATGACAGATTGAGAATGCTCGATGTCCAAATCCGGAAAGCAGTCGGACAGTGGCTTAGGCTACCGGCGGATGTGTCCAAGGCATACTATCACGCCGCAGTTCAGGACGGCGGCTTAGCGATCCCATCGGTGCGAGCGACCATCCCGGACCTCATTGTGAGGCGTTTCGGGGGGCTCGACTCGTCACCATGGTCAGTGGCAAGAGCCACCGCCAAATCTGAAAAGATTCTTGCTCCTGGACTGTCGTCCTCGGCGCCTGTCACCCCGGCTGACCCAGTGGCTGGTGTCCCTGATTTCCCCATTCCTGTAGCGTCAGGGGCTCCGACTGGACCCCTTGATGTAGCAGCGCAGGGGAGGCTGGAGCTGCTCGAGCAGGCAAACCGAGCGGTGCGTGGGATAATGTCGGTGGCGACGGCGGCATCCAAACTCAACAAGTCGGAGGTCAATGTGATCTCCGAATTTGGTCGCGATATCCTGGCCGTAGTTGGGGCCCTCGGGATCCAGCTCTCAGAAAAGGAGCTGGTGGTCGAAAGGCTCCGCTCGGCAGAGGCCTCTGCACGGCGTGACGCCTTGGTACCTTCGATGGCTGCTGGTGCGGCGGCCGGGTCTGGGACTGGGCCTGCGACTTTTGCCACTGTCCTCAAGACGGGCCCTGGTGGGGTCCCGAGGTCCATTGGGGCCTCTCAGGGGCCTTCCTTGGCATTTTACCCGTCCGAGGGCAATGCAGAACTGAAGACAGCGGAGGACACAAAGAAGGAGGTGAAAAAGGCCATTGACCCTAAGTCAATGGCAATTGGAATACGGAGCGTAAGGAAGGTCGGGAATGCGGGGGTAGTGGTGCAGACCACGTCCCCCGCGGCTGCAGTTAAGCTGAGAAATGCGGCCCCGCCATCACTAAGAGTCACCGAACCCAGGCGCCGACAGCCCTTAGTGGCTGTCAATGGTGTGGAGGGTGACCCCTCCTTCGAGGAGGTAATTGAGTGCCTGGCTAGCCAGAACCTTGACCCGGAGGAGTGGCCCCTCACTAGGATTCGAGCGGAGCTCACGGGGGCGTTCAAAAAGGGGAGGCGACAGTCCAACAACACTACTGTGGTGTTCAACGCCTCCCCTCGCATCAGGGACGCCCTCGTGAAGCTTGGCAGAGTGTCGAGTATGGATATTAGGCCCCGACTTCGTATTGGCCAAATCAATCTGGGTGGTGCAGAGGATGCGACGAGGGAGCTACCCTCCATTGCACGTGATCTCGGCCTGGATATTGTTCTTGTACAGGAACAATATTCCATGGTCGGGTTCCTAGCCCAATGTGGAGCACACCCCAAGGCGGGTGTGTATATCCGCAACAGGGGGCTCCCCTGCGCGGTTCTGCAACACCTTAGCAGCACACACATGACGGTAATGCACATTGGGGGGTGGGACTTATATATGGTGTTTGCGTACTTCCAGTATAGTGACCCTATTGACCCATACCTGCACCGGCTCGGGAATATTCTTGACCGGTTGCGGGGGGCTCGGGTGGTCATCTGCGCAGACACTAATGCCCACTCGCCATTGTGGCATTCGCTGCCCAGGCACTACGTCGGTCGGGGTCAGGAAGTGGCTGACCGCCGCGCCAAGATGGAGGATTTCATTGGGGCGAGGCGGTTGGTCGTCCATAACGCGGAGGGCCACCTGCCGACCTTCTGTACGGCGAACGGAGAATCTTATGTCGATGTCACGCTGTCCACGCGGGGAGTACGCGTGTCTGAATGGCGCGTAACTGATGAATCATCGAGCGATCACCGGCTCATCGTGTTTGGGGTGGGGGGCGGTACAACAGGGGAGCGGGACGAGGACGAGGAGGCGCGGAGCGATTTGAGGCCGTGCGAGCCGTGTGCACTGCGTCGGTACCGGGACCGTGGGGTGGATTGGGACCTCTTCAGATCGCGGATCCATGAGCGATTGGGGAGTCTGGACCTCGAGGAACCTGCGGCTGCCCTTTGCGAAAAATTTACCGGGGTTATAGCACGCACCGCTGCAGAATGCTTAGGATCAGTGAAAGCAGATAGAACTGACAGGGGTTATGAGTGGTGGACCCCGGTACTCGATAAGCTTAGGGTAGCCCAGGGTAAGGCCAGGCGTCGATGGCAAAAGGCCCGCAGAACAGGGGGTGAGGAAGAGGAGCAGGCTGGGAGAGTCTTCCGCGACCGCAGGCGCGAGTATCGAAGAGCGATGCATGACGCCGAGACCGCCTTTTACCGGGAGATCGCTGAAGGGGGAAACCGTGACCCGTGGGGACTAGCGTATCGGACGGCGAGTGGTAGGCGACGCGCACCAACCAATGTGGTTAACGGGGTGGAGTATGCGGGGCGGTGCTCGGATGATGTGAGTGGGGCCATGTGCACCTTGATGTGGGCGCTGTGTCCGGATGACTATATGTCTCGGGACACTCCGTACCATTCACGGGTGCGTATCATGGCCGCGCTCCCCCCATCCGGGCGGGACGCAGACCCGCTGAGCAAAGACTCCCTTCGTGCCATAATTGGCTCACTGAGGAATACCGCACCGGGCATCGACGGTTTAACGGCGCGCATTATCAAAAAGGCACTTCCGGCTGCTGAGGCCGAGTTCGCGGCCGTATACGCACGGTGCGTTGTGGAGGGGACCTTCCCACCGGTGTGGAAGGATGGCCGCCTACTTGTTCTGTCAAAGGGGAATGGCAGGCCCTTAACGGACCCCAAGGCGTATCGCCCGGTCACCTTGCTGCCGGTCCTGGGAAAGATCCTGGAGAGGGTACTATTGCAGTGTGCTCCTGGCCTCACCCAAAGTATTAGTCCGCGCCAGCACGGGTTCTCTCCTGGATGCTCGACGGTGACGGCGCTGCAAACTCTGCTGGACGTGTCGCGCGCCTCGGAGCAGAGGTACGTAATGGCCATATTCTTGGACATCAGTGGCGCTTTCGATAACGCGTGGTGGCCCATGATAATGGTGAAGGCCAAGCGGAACTGTCCGCCCAACATCTATCGGATGCTGACGGACTATTTCCGCGGACGCCGTATCGCCGTTGTCGCGGGGGACTGTGCGGAATGGAAGGTGTCCACGATGGGCTGTCCGCAGGGTTCAGTGCTCGGGCCGACGCTCTGGAACGTTCTGATGGATGACCTGCTCGCCTTGCCGCAGGGGGTAGAGGGAACAGAGATGGTCGCCTATGCCGATGACGTGACGGTACTGGTTAGGGATGACTCACGGGCGCAGCTTGAGAGGAGAGCGCACGCCGTGCTAGGACTCGCAGAGGGTCCGGCTTTGCGTGTCTTGTACATGGGCACTTATGTTACAACCCTTACCTATGCGGCGGCCGTATGGTACTTGCGGGCTGCTGTGCACGTCGTGCGCAGCGTGCTGCTTAGGACGCAGCGCCCGTCGTTGACACTGCTAACGAAGGCATATCGCTCGTGCAGCACGGCTGCTTTGCCGGTGTTGGCGGGCGTCCTGCCGGCGGACCTGGAGGTAACTCGTGCTGGACGGAGGATGCGGGAGTGCGGAGGATTGGCGCGGGAGTTGGCGGCGGAAAGACGACGGCGGATTGACAGTGATGCCTTGGCAATTTGGCAGGACAGGTGGGTGTCTGAGGGTAAGGGGAGGGAACTGTTCAAGTTCTTTCCCGATGTTGTGGGCAGGAGGAAGGCAACGTGGATAGAGCCGGATTATCAGACCTCGCAGATCCTCACGGGACACGGGATCTTCAATAAGCGGTTGGCGGATATGCGACTGAGGGAGGGGCATGCTTGCGACTGCGGGGCGGTTGAGGAGGACAGGGACCATGTCCTGTGGGAGTGCCCTCTATACGACGAAATCCGGGGCAGGATGCTCGATGGAATCTCGCGGTCTGAGGTGGGCCCAGTTTACCACGCGGACCTGGTCAGGGACGAGCATAACTTTCGGCTCTTGCTCGAGTTCGCGCATGCATGGCACACGGCGCGCACTGCGCGCGAATCACGAGGACTGCCTGGCGACGAAGAATATTTTCTAGCTAAGCCACCGGACACAGGAAAATTTCTGGCGCTAAAAACGAAATTATTATCAACATTTGAAGAGTCCAAAAGTCGACAAATTGAAAGACTCATAGGAGAGATGGAACTAGGAGATCAAAAACCTTCTCAGCTATTGCACCGCATGAGAGAGTTAGCCAGAGATAAAGTACCGGACGACACCCTGCGAGTGTTATGGCAAGGTCACTTACCTACAACATTGAGGGCAATCCTTACAGTCACTGAAACAAAAGATTTAGACAACCTCGCCATGATTGCGGATAATGTTGCGGAGGCCACGCGAGTTAACCACATCTCTGAGGTCGTTAATCAGCAAACCTCGAATATGGAACGACCATCAACAAGCGACACGTCTTTAATTTTAGCGGAAATAGCAAAATTAAGCGTCAGAATGACTAACATGGAGCAGTCACGATCCAGACAAAACTACTTTGATCGTAACCGTGATAGAAGTGGCTCACGATCTTCATCGAGACGCCGTACCCCACAGAACCCCAACTGGTTATGTTACTACCATTACAAGTTCCGTCAGAATGCTCAGAAATGCGTCCAACCATGTGCATGGAAACCAAGTTCGGAAAACTAG
Protein
MGPATEGYTVAKKFIKGNRPEASGLPLESERTGDNPTVRGSAGADPVGQDAPGWTCQFCERSFSTNRGLGVHKRRAHPVETNTDAAPMMVKRRWHGEEVDLLARTEARLLAERGQCSGGDLFGELPGFGRTLEAIKGQRRREPYRELVQAHLARSGSQPGPSSGGCSAEPDFRRASGAEEAGEERCAEDAAAYDPSAVGQMSPDAARVLSELLEGAGRRRACRAMRPKTAGRRNDLHDDRTASAHKTKRQKRRAEYARVQELYKKCRSRAAAEVIDGACGPPVWTVLWRIPQYWTRCLGIAGRSCGRECHVAVLDFAKAFDTVSHEALVELLRLRGMPVQFCGYIAHLYDTASTTLAVNNEMSSPVKVGRGVRQGDPLSPILFNVVMDLILASLPERVGYRLEMELVSALAYADDLVLLAGSKVGMQESISAVDCVGRQMGLRLNCRKSAVLSMIPDGHRKKHHYLTERTFNIGGKLLRQVSCVERWRYLGVDFEASGCVTLEHSISSALNNISRAPLKPQQRLEILRAHLIPRFQHGFVLGNISDDRLRMLDVQIRKAVGQWLRLPADVSKAYYHAAVQDGGLAIPSVRATIPDLIVRRFGGLDSSPWSVARATAKSEKILAPGLSSSAPVTPADPVAGVPDFPIPVASGAPTGPLDVAAQGRLELLEQANRAVRGIMSVATAASKLNKSEVNVISEFGRDILAVVGALGIQLSEKELVVERLRSAEASARRDALVPSMAAGAAAGSGTGPATFATVLKTGPGGVPRSIGASQGPSLAFYPSEGNAELKTAEDTKKEVKKAIDPKSMAIGIRSVRKVGNAGVVVQTTSPAAAVKLRNAAPPSLRVTEPRRRQPLVAVNGVEGDPSFEEVIECLASQNLDPEEWPLTRIRAELTGAFKKGRRQSNNTTVVFNASPRIRDALVKLGRVSSMDIRPRLRIGQINLGGAEDATRELPSIARDLGLDIVLVQEQYSMVGFLAQCGAHPKAGVYIRNRGLPCAVLQHLSSTHMTVMHIGGWDLYMVFAYFQYSDPIDPYLHRLGNILDRLRGARVVICADTNAHSPLWHSLPRHYVGRGQEVADRRAKMEDFIGARRLVVHNAEGHLPTFCTANGESYVDVTLSTRGVRVSEWRVTDESSSDHRLIVFGVGGGTTGERDEDEEARSDLRPCEPCALRRYRDRGVDWDLFRSRIHERLGSLDLEEPAAALCEKFTGVIARTAAECLGSVKADRTDRGYEWWTPVLDKLRVAQGKARRRWQKARRTGGEEEEQAGRVFRDRRREYRRAMHDAETAFYREIAEGGNRDPWGLAYRTASGRRRAPTNVVNGVEYAGRCSDDVSGAMCTLMWALCPDDYMSRDTPYHSRVRIMAALPPSGRDADPLSKDSLRAIIGSLRNTAPGIDGLTARIIKKALPAAEAEFAAVYARCVVEGTFPPVWKDGRLLVLSKGNGRPLTDPKAYRPVTLLPVLGKILERVLLQCAPGLTQSISPRQHGFSPGCSTVTALQTLLDVSRASEQRYVMAIFLDISGAFDNAWWPMIMVKAKRNCPPNIYRMLTDYFRGRRIAVVAGDCAEWKVSTMGCPQGSVLGPTLWNVLMDDLLALPQGVEGTEMVAYADDVTVLVRDDSRAQLERRAHAVLGLAEGPALRVLYMGTYVTTLTYAAAVWYLRAAVHVVRSVLLRTQRPSLTLLTKAYRSCSTAALPVLAGVLPADLEVTRAGRRMRECGGLARELAAERRRRIDSDALAIWQDRWVSEGKGRELFKFFPDVVGRRKATWIEPDYQTSQILTGHGIFNKRLADMRLREGHACDCGAVEEDRDHVLWECPLYDEIRGRMLDGISRSEVGPVYHADLVRDEHNFRLLLEFAHAWHTARTARESRGLPGDEEYFLAKPPDTGKFLALKTKLLSTFEESKSRQIERLIGEMELGDQKPSQLLHRMRELARDKVPDDTLRVLWQGHLPTTLRAILTVTETKDLDNLAMIADNVAEATRVNHISEVVNQQTSNMERPSTSDTSLILAEIAKLSVRMTNMEQSRSRQNYFDRNRDRSGSRSSSRRRTPQNPNWLCYYHYKFRQNAQKCVQPCAWKPSSEN

Summary

Uniprot
ProteinModelPortal
PDB
6A42     E-value=4.24858e-122,     Score=1128

Ontologies

Topology

Length:
2081
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
3.01618
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00007
outside
1  -  2081
 
 

Population Genetic Test Statistics

Pi
21.47983
Theta
19.293272
Tajima's D
0
CLR
0.258119
CSRT
0.369881505924704
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号