SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06306
Annotation
T18197_reverse_transcriptase-like_protein_-_silkworm
Location in the cell
Nuclear   Reliability : 2.138
 

Sequence

CDS
ATGATGGTGAAGCGGCGGTGGCATGGCGAGGAAGTCGACCTCCTCGCTCGCACCGAGGCCAGGTTGCTCGCTGAGCGGGGTCAGTGCTCGGGTGGAGACCTCTTTGGCGCGCTCCCAGGGTTTGGAAGAACTCTGGAAGCGATTAAGGGACAACGGCGGAGGGAGCCTTATCGGGCATTGGTGCAAGCGCACCTTGCCCGATCTGGTTCCCAGCCGGGTCCCTCGTCAGGGGGGTGCTCGGCCGAGCCTGACTTCCGGCGGGCTTCTGAAGCTGAGGAGGCGGGCGAGGAACGATGCGCCGAAGACGCCGCTGCCTATGATCCATCCGCAGTCGGTCAGATGTCGCCCGATGCCGCTCGGGTTCTCTCCGAACTCCTTGAGGGTGCGGAGAGAAGACGAGCGTGCAGGGCTATGAGACCCAAGACTGCAGGGCGGCGAAACGATTTGCACGATGATCGGACAGCTAGTGCCCACAAAACCAATAGACAAAAGCGCAGAGCAGAGTACGCGCGTGTGCAGGAACTGTACAAGAAGTGTCGCAGCAGAGCAGCAGCTGAGGTGATCGATGGCGCGTGTGGGGGGCGTGCGGAGTGGCACGGGGGCAATCGCGACTACACCCAGCTGTGGAAGCCGATCTCGGTGGAAGAGATCAAGGCCTCCCGCTTTGACTGGCGAACTTCGCCGGGCCCGGACGGTATACGTTCGGGTCAGTGGCGTGCGGTTCCTGTGCACTTGAAGGCGGGAATGTTCAATGCATGGATGGCACGAGGCGAAATACCCGAAATTCTACGGCAGTGCCGAACCGTCTTTGTGCCTAAGGTGGAGAGACCAGGTGGACCGGGGGAATATCGACCGATCTCGATCGCGTCGATTCCCCTGAGACACTTTCACTCCATCTTGGCCCGGAGGCTGTTGGCTTGCTGCCCCCCTGACGCACGACAGCGTGGATTTATCTGCGCCGACGGTACGCTGGAGAATTCCGCAGTACTGGACGCGGTGCTTGGGGATAGCAGGAAGAAGCTGCGGGAATGTCACGTGGCGGTGCTAGACTTCGCCAAGGCATTTGACACTGTGTCTCACGAGGCACTTGTCGAATTGCTGAGGTTGAGGGGCATGCCCGAACAGTTCTGCGGCTACATTGCTCACCTATACGATACGGCGTCCACCACCTTAGCCGTGAACAATGAAATGAGCAGCCCTGTGAAAGTGGGACGAGGGGTTCGTCAAGGGGACCCTCTGTCGCCAATACTCTTCAACGTGGTGATGGACCTCATCCTAGCTTCCCTGCCGGAGAGGGTCGGGTATAGGTTGGAGATGGAACTCGTGTCCGCTCTGGCCTATGCTGACGACCTAGTCCTGCTTGCGGGGTCGAAGGTAGGGATGCAGGAGTCCATCTCTGCTGTGGACTGTGTTGGTAGGCAGATGGGCCTACGCCTGAATTGCAGGAAGAGCGCGGTTCTGTCTATGATACCGGATGGCCACCGCAAGAAGCATCACTACATGACTGAGCGAACCTTCAATATTGGAGGTAAGCCGCTCAGGCAGGTGAGTTGTGTTGAGCGGTGGCGATATCTTGGTGTCGATTTTGAGGCCTCTGGATGCATGACATTAGAGCATAGTATCAGTAGTGCTCTGAATAACATCTCAAGGGCACCTCTCAAACCCCAACAGAGGTTGGAGATTTTGAGAGCTCATCTGATTCCGAGGTTCCAGCACGGTTTCGTGCTTGGAAACATCTCGGATGACAGATTGAGAATGCTCGATGTCCAAATCCGGAAAGCAGTCGGACAGTGGCTTGGGCTACCGGCGGATGTGCCCAAGGCATACTATCACGCCGCAGTTCAGGACGGCGGCTTAGCGATCCCATCGGTGCGAGCGACCATCCCGGACCTCATTGTGAGGCGTTTCGGGGGGCTCGACTCGTCACCATGGTCAGTGGCAAGAGCCGCCGCCAAATCTGATAAGATTCGTAAGAAACTGCGGTGGGCTTGGAAACAGGCATACCGTTCGTGCAGCACGGCTGCTTTGCCGGTGTTGGCGGGCGTCCTGCCGGCGGACCTGGAGGTGACTCGTGCTGGACGGAGGATGCGGGAGTGCGAAGGATTGGCGCGGGAGTTGGCGGCGGAGAGACGACGGCGGATCGACAGTGATGTCTTGGCAATTTGGCAGGACAGCCCAACCGCAGTGGGTTTACCTGTTGCAAAAAAGTCAGATAAAGAGAATAGACCTGAAGCCTCTGGCCTCCCGCTGGAGTCAGAGAGGACAGGCGATAACCCGACTGTGCGGGGTTCCGCCGGCGCAGATCCTGTGGGTCAGGATGCGCCTGGTTGGACCTGCCAGTTCTGCGAACGATCCTTTTCGACCAACAGGGGTTTGGGTGTCCACAAGCGTAGAGCCCACCCTGTTGAGACCAATACGGATGCCGCTCCGATGATGGTGAAGCGGCGGTGGCATGGCGAGGAAGTCGACCTCCTCGCTCGCACCGAGGCCAGGTTGCTCGCTGAGCGGGGTCAGTGCTCGGGTGGAGACCTCTTTGGCGCGCTTCCAGGGTTTGGAAGAACACTGGAAGCGATTAAGGGACAACGGCGGAGGGAGCCTTATCGGGCATTGGTGCAAGCGCACCTTGCCCGATATGGGTCCCAGCCGGGTCCCTCGTCAGGGGGGTGCTCGGCCGAGCCTGACTCCCGGCGGGCTTCTGGAGCTGAGGAAGCGAGCGAGGAACGATGCGCCGAAGACGCCGCTGCCTATGATCCATCCGCAGTCGTTCAGATGTCGCCCGATGCCGCTCGGGTTCTCTCCGAACTCCTTGAGGGTGCGGGGAGAAGACGAGCGTGCAGGGCTATGAGACCCAAGACTGCAGGGCGGCGAAACGATTTGCATGATGATCGGCCAGCTAGTGCCCACAAAACCAAAAGACAAAAGCGCAGAGCGGAGTACGCGCGTGTGCAGGAACTATACAAGAAGTGTCGCAGCAGAGCAACAGCTGAAGTGATCGATGGCGCGTGTGGGGGTGTCGGACACTCGCTCGAGGAGATGGAGGCCTATTGGCGACCTATCCTCGAGAGGATGTCCGACGCACCTGGGCCTACACCGGAAGTTCTTCACGCCCTAGGGCGTGCGGAGCGGCACGGGGGCAATCGCGACTACACCCAGCTGTGGAAGCCGATCTCGTGGCGTGCGGTTCCTGTGCACTTGAAGGCGGAAATGTTCAATGCATGGATGGCACGAGGCGAAATACCCGAAATTCTACGACAGTGCCGAACCGTCTTTGTGCCTAAGGTGGAGAGACCAGGTGGACCGGGGGAATATCGACCGATCTCGATCGCGTCGATTCCCCTGAGACACTTTCACTCCATCTTGGCCCGGAGGCTGTTGGCTTGCTGCCCTCCTGACGCACGACAGCGTGGATTTATCTGCGCCGACGGTACTCTGGAGAATTCCGCAGTACTGGACGCGGTGCTTGGGGATAGCAGGAAGAAGCTGCGGGAATGTCACGTGGCGGTGCTAGACTTCGCCAAGGCATTCGACACTGTGTCTCACGAGGCACTTGTCGAATTGCTGAGGTTGAGGGGCATGCCCGAACAGTTCTGCGGCTATATTGCTCACCTATACGATACGGCGTCCACCACCTTAGCCGTGAACAATGAAATGAGCAGCCCTGTGAAAGTGGGACGAGGGGTTCGTCAAGGGGACCCTCTGTCGCCAATACTCTTCAACGTGGTGATGGACCTCATCCTAGCTTCCCTGCCGGCGAGGGTCGGGTATAGGTTGGAGATGGAACTCGTGTCCGCTCTGGCCTATGCTGACGACCTAGTCCTGCTTGCGGGGTCGAAGGTAGGGATGCAGGAGTCCATCTCTGGTGTGGAGTGTGTCGGTAGGCAGATGGGCCTTCGCCTGAACTGCAGAAAAAGCGCTGTCTTGTCTATGATACCAGATGGCCACCGCAAGAAGCATCACTACCTGACTGAGCGAACCTTCAATATTGGAGGTAAGCCGCTCAGGGCATCTCTCAAACCCCAACAGAGGTTGGAGATTTTGAGAGCTCATCTGATTTTGAGATTCCAGCATGGTTTCGAGCTTGGAAACATCTCGGATGACAGATTGAGAATGCTCGATGTCCAAATCCGGAAAGCAGTCGGACAGTGGCTTAGGCTACCGGCGGATGTGCCCAAGGCGTACTATCACGCCGCAGTTCAGGACGGCGGCTTAGCGATCCCATCGGTGCGAGCGACCATCCCGGACCTCATTGTGAGGCGTTTCGGGGGGCTCGACTCGTCACCATGGTCAGTGGCAAGAGCCGCCGCCAAATCTGATAAGATTCGTAAGAAACTGCGGTGGGCTTGGAAACAGGAGGAGAGGGGGCAATTTTCCCCTCGGGTCTCTTTGGCGCGCTCGCCGCCTAGGGGACTGACTGCACCTCTGCCGGCGCCTATGCCGCCGCCGGCCCCCCGGGGGGCTAAAGCGGGGGCAGCTGTGAGTGCCAAAGGCTGGAGGACCGGCCTGCATATTCCAGTTACTCCTGGACTGTCGTCCTCGGCGCCCGTCACCCCGGTTGACCCAGTGGCTGGTGTCCCTGACTTCCCCACTCCTGTAGCGTCAGGGGCTCCGACGGGACCCCTTGATGTAGCAGCGCAGGGGAGGCTGGAGCTGCTCGAGCGGGCAAACCGAGCGGTGCGTGGGATAATGTCGGTGGCGACGGCGGCATCCAAGCTCAACAAGTCGGAGGTCAATGTGATCTCCGAATTTGGTCGCGATATCCTTGCCGTAGTTGGGGCCCTCGGGATCCAGCTCTCAGAAAAGGAGCTGGTGGTCGAGAGGCTCCGCTCGGCAGAGGCCTCCGCACGGCGTAACTCCTTGGTACCTTCGATAGCTGCTGGTGCGGCGGCCGGGTCTGGGATTGGGCCTGCGACTTTTGCCACTGTCATCAGGACGGGCCCTGATGGGGTCCCGAGGTCCATTGGGACCTCTCAGGGGCCTTCTTTGGCATTTTACCCGTCCGAGGGCAATGTAGAACTAAAGACAGCGGAGGATACGAAGAAGGAGGTGAAAAAGGCCATCGATCCCAAGTCGATGGCAATTGGAATACGGAGTGTAAGGAAGGTCGGGAATGCGGGGGTACTGGTGCAGACCACGTCCCCCGCGGCTGCAGTTACGCTGAGAAATGCGGCCCCGCCATCACTTAGAGTCACCGAACCCAGGCGCCGACAGCCCTTAGTGGCTGTTAATGGAGTGGAGGGTGACCCCTCTTTCGAGGAGCCGGGTCCCTCGTCAGATGGGTGCTCGGCCGAGCCTGACTTCCGGCGGGCTTCTGAAGCTGAGGTAGCGGGCGTGGAACGATGCGCCGAAGACGCCGCGGCCTATGATCCATCCGCAGTCGGTCAGATGTCGCCCGATGCCGCTCGGGTTCTTTCGGAGAGAAGACGAGCGCGCAGGGTTATGAGACCCAGGACTGCAGGGCGGCGAAACGATTTGAACGATGATCTGGCTGCTAGTGCCCACAAAGCAAAAAAACAGAAGCGCAGAGCGGAGTACGCGCGTGTGCAGGAGCTGTACAAGTGTCGCAGCAGAGCAGCAGCTGAAGTGATCGATGGCGCGTGTAGGGGTGTCGGACACTCGCTCGAGGGGATGAGAGGCTTATTGGCGACCTATCCTCGAGAGGGTGTCCGACGCACCTGGGCCTACATCGGAAGCTCTTCATGTCTTATGGCGTGCGGAGCAGCACGGGGGCAATCGCGACTACACTCAACTGTGGAGGCCGATCTCAGTGGAAGAGATCAAGGCTTCCCCCGCTTTGACTGGCGGACTTCACCGGGCCCGGACGGTATACGTCCGGCAAAAGAAGATTAA
Protein
MMVKRRWHGEEVDLLARTEARLLAERGQCSGGDLFGALPGFGRTLEAIKGQRRREPYRALVQAHLARSGSQPGPSSGGCSAEPDFRRASEAEEAGEERCAEDAAAYDPSAVGQMSPDAARVLSELLEGAERRRACRAMRPKTAGRRNDLHDDRTASAHKTNRQKRRAEYARVQELYKKCRSRAAAEVIDGACGGRAEWHGGNRDYTQLWKPISVEEIKASRFDWRTSPGPDGIRSGQWRAVPVHLKAGMFNAWMARGEIPEILRQCRTVFVPKVERPGGPGEYRPISIASIPLRHFHSILARRLLACCPPDARQRGFICADGTLENSAVLDAVLGDSRKKLRECHVAVLDFAKAFDTVSHEALVELLRLRGMPEQFCGYIAHLYDTASTTLAVNNEMSSPVKVGRGVRQGDPLSPILFNVVMDLILASLPERVGYRLEMELVSALAYADDLVLLAGSKVGMQESISAVDCVGRQMGLRLNCRKSAVLSMIPDGHRKKHHYMTERTFNIGGKPLRQVSCVERWRYLGVDFEASGCMTLEHSISSALNNISRAPLKPQQRLEILRAHLIPRFQHGFVLGNISDDRLRMLDVQIRKAVGQWLGLPADVPKAYYHAAVQDGGLAIPSVRATIPDLIVRRFGGLDSSPWSVARAAAKSDKIRKKLRWAWKQAYRSCSTAALPVLAGVLPADLEVTRAGRRMRECEGLARELAAERRRRIDSDVLAIWQDSPTAVGLPVAKKSDKENRPEASGLPLESERTGDNPTVRGSAGADPVGQDAPGWTCQFCERSFSTNRGLGVHKRRAHPVETNTDAAPMMVKRRWHGEEVDLLARTEARLLAERGQCSGGDLFGALPGFGRTLEAIKGQRRREPYRALVQAHLARYGSQPGPSSGGCSAEPDSRRASGAEEASEERCAEDAAAYDPSAVVQMSPDAARVLSELLEGAGRRRACRAMRPKTAGRRNDLHDDRPASAHKTKRQKRRAEYARVQELYKKCRSRATAEVIDGACGGVGHSLEEMEAYWRPILERMSDAPGPTPEVLHALGRAERHGGNRDYTQLWKPISWRAVPVHLKAEMFNAWMARGEIPEILRQCRTVFVPKVERPGGPGEYRPISIASIPLRHFHSILARRLLACCPPDARQRGFICADGTLENSAVLDAVLGDSRKKLRECHVAVLDFAKAFDTVSHEALVELLRLRGMPEQFCGYIAHLYDTASTTLAVNNEMSSPVKVGRGVRQGDPLSPILFNVVMDLILASLPARVGYRLEMELVSALAYADDLVLLAGSKVGMQESISGVECVGRQMGLRLNCRKSAVLSMIPDGHRKKHHYLTERTFNIGGKPLRASLKPQQRLEILRAHLILRFQHGFELGNISDDRLRMLDVQIRKAVGQWLRLPADVPKAYYHAAVQDGGLAIPSVRATIPDLIVRRFGGLDSSPWSVARAAAKSDKIRKKLRWAWKQEERGQFSPRVSLARSPPRGLTAPLPAPMPPPAPRGAKAGAAVSAKGWRTGLHIPVTPGLSSSAPVTPVDPVAGVPDFPTPVASGAPTGPLDVAAQGRLELLERANRAVRGIMSVATAASKLNKSEVNVISEFGRDILAVVGALGIQLSEKELVVERLRSAEASARRNSLVPSIAAGAAAGSGIGPATFATVIRTGPDGVPRSIGTSQGPSLAFYPSEGNVELKTAEDTKKEVKKAIDPKSMAIGIRSVRKVGNAGVLVQTTSPAAAVTLRNAAPPSLRVTEPRRRQPLVAVNGVEGDPSFEEPGPSSDGCSAEPDFRRASEAEVAGVERCAEDAAAYDPSAVGQMSPDAARVLSERRRARRVMRPRTAGRRNDLNDDLAASAHKAKKQKRRAEYARVQELYKCRSRAAAEVIDGACRGVGHSLEGMRGLLATYPREGVRRTWAYIGSSSCLMACGAARGQSRLHSTVEADLSGRDQGFPRFDWRTSPGPDGIRPAKED

Summary

Uniprot
ProteinModelPortal
PDB
6AR3     E-value=0.0410017,     Score=93

Ontologies

Topology

Length:
1948
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.032
Exp number, first 60 AAs:
0.0013
Total prob of N-in:
0.00023
outside
1  -  1948
 
 

Population Genetic Test Statistics

Pi
1.371643
Theta
0.80393
Tajima's D
1.293945
CLR
0.868292
CSRT
0.805759712014399
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号