SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06304
Annotation
T18197_reverse_transcriptase-like_protein_-_silkworm
Location in the cell
Nuclear   Reliability : 3.703
 

Sequence

CDS
ATGATGGTGAAGCGGCGGTGGCATGGCGAGGAAATCGACCTCCTCGCTCGCACCGAGGCCAGGTTGATCGCTCAACGAGGTCAGTGCTCGGGTGGAGACCTTTTTGGCGCGCTTCCGGGGTTGGGAAGAACCCTGGAAGCAATTAAGGAACAACGGCGAAGGGAGCCTTATAGGGCATTGGTGCTAGCGCACCTTGCCCGATTTGGTTCCCAGCCGGGTCCCTCGTCAGATGGGCGCTCGGCCGAGCCTGACTTTCGGCGGGCTTCTGGAGCTGAGGAAGCGGGTGTGGAACGATGCGCCGAAGACGCCGCGGCCTATGATCCATCCGCAGTCGGTCAGATGTCGCCCGATGCCGCTCGGGTTCTCTCCGAACTCCTTGAGGGTGCGGGGAGAAGACGAGCGTGCAGGGCTATGAGACCCAGGACTGCAGGGCGGCGAAACGAGTTGCACGATGATCCGGCTGCTAGTGCCCGAAAATCAAATAGACAGAAGCGCAGAGCAGAGTACGCGCATGTACAGAAGCTGTACAAGAAGTGTCGCAGCAAAGCAGCAGCTGAGCGTAGAGCCCACCCTGTTGAGATCAATACGGATGCCGCTCCGATGATGGTGAAGCAGCGGTGGCATGGCGAGGAAATCGACCTCCTCGCTCGCACCGAGTCCAGTTTGATCGCTCAACGAGGTCAGTGCTCGGGTGGAGACCTTTTTGGCGCGCTTCCGGGGTTGGGAAGAACCCTGGAAGCAATTAAGGAACAACGGCGAAGGGAGCCTTATAGGGCATTGGTGCTAGCGCACCTTGCCCGATTTGGTTCCCAGCCGGGTCCCTCGTCAGATGGGCGCTCGGCCGAGCCTGACTTCCGGCGGGCTTCTGGAGCTGAGGTAGCGGGCGTGGAACGATGCGCCGAAGACGCCGCGGCCTATGATCCATCCGCAGTCGGTCAGATGTCGCCCGATGCCGCTCGGGTTCTTTCGGAGAGACGACGAGCGTGCAGGGTTATGAGACCCAGGACTGCAGGGCGGCGAAACGATTTGAACGATGATCTGGCTGCTAGTGCCCACAAAGCCAAAAAAAAAGAAGCGCAGAGCGGAGTACGCGCGTGTGCAGGAGCTGTACAAGTGTCGCAGCAGAGCAGCAGCTGA
Protein
MMVKRRWHGEEIDLLARTEARLIAQRGQCSGGDLFGALPGLGRTLEAIKEQRRREPYRALVLAHLARFGSQPGPSSDGRSAEPDFRRASGAEEAGVERCAEDAAAYDPSAVGQMSPDAARVLSELLEGAGRRRACRAMRPRTAGRRNELHDDPAASARKSNRQKRRAEYAHVQKLYKKCRSKAAAERRAHPVEINTDAAPMMVKQRWHGEEIDLLARTESSLIAQRGQCSGGDLFGALPGLGRTLEAIKEQRRREPYRALVLAHLARFGSQPGPSSDGRSAEPDFRRASGAEVAGVERCAEDAAAYDPSAVGQMSPDAARVLSERRRACRVMRPRTAGRRNDLNDDLAASAHKAKKKEAQSGVRACAGAVQVSQQSSS

Summary

Uniprot
ProteinModelPortal

Ontologies

GO

Topology

Length:
378
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00207
Exp number, first 60 AAs:
0.00153
Total prob of N-in:
0.03477
outside
1  -  378
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
1.753945
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号