SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06303
Annotation
T18197_reverse_transcriptase-like_protein_-_silkworm
Full name
Retrovirus-related Pol polyprotein from type-1 retrotransposable element R2      
Alternative Name
Retrovirus-related Pol polyprotein from type I retrotransposable element R2
Location in the cell
Mitochondrial   Reliability : 1.501 Nuclear   Reliability : 1.883
 

Sequence

CDS
ATGATGGTGAAGCGGCGGTGGCATGGCGAGGAAGTCGACCTCCTCGCTCGCACCGAGGCCAGGTTGCTCGCTGAGCGGGGTCAGTGCTCGGGTGGAGACCTCTTTGGCGCGCTTCCAGGGTTTGGAAGAACTCTGGAAGCGATTAAGGGACAACGGCGGAGGGAGCCTTATCGGGCATTGGTGCAAGCGCACCTTGCCCGATTTGGTTCCCAGCCGGGTCCCTCGTCAGGGGGGTGCTCGACCGAGCCTGACTTCCGGCGGGCTTCTGGAGCTGAGGATGCGGGCGAGGAACGATGCGCCGAAGACGCCGCTGCCTATGATCCATCCGCAGTCGGTCAGATGTCGCCCGATGCCGCTCGGGTTCTCTCCGAACTCCTTGAGGGTGCGGGGAGAAGACGAGCGTGCAGGGCTATGAGACCCAAGACTGCAGGGCGGCGAAACGATTTGCACGACGATCGGACAGCTAGTGCCCACAAAACGAGAAGACAAAAGCGCAGAGCAGAGTACGCGCGTGTGCAGGAACTGTACAAGAAGTGTCGCAGCAGAGCAGCAGCTGAAGTGATCGATGGCGCGTGTGGGGGTGTCGGACACTCGCTCGAGGAGATGGAGACCTATTGGCGACCTATCCTCGAGAGAGTGTCCGACGCACCTGGGCCTACACCGGAAGCTCTGCACGCCCTAGGGCGTGAGGAGCGGCACGGGGGCAATCGTGACTACACCCAGCTGTGGAAGCCGATCTCGGTGGAAGAGATCAAGGCCTCCCGCTTTGACTGGCGAACTTCGCCGGGCCCGGACGGTATACGTTCGGGTCAGTGGCGTGCGGTTCCTGTGCACTTGAAGGCGGAAATGTTTAATGCATGGATGGCACGAGGCGAAATACCCGAAATTCTACGGCAGTGCCGAACCGTCTTTGTGCCTAAGGTGGAGAGACCAGGTGGACCGGGGGAATATCGACCGATTTCGATCGCGTCGATTCCCCTGAGACACTTTCACTCCATCTTGGCCCGGAGGCTGTTGGCTTGCTGCCCCCCTGACGCACGACAGCGCGGATTTATCTGCGCCGACGGTACGCTGGAGAATTCCGCAGTACTGGACGCGGTGCTTGGGGATAGCAGGAAGAAGCTGCGGGAATGTCACGTGGCGGTGCTAGACTTCGCCAAGGCATTTGACACTGTGTCTCACGAGGCACTTGTCGAATTGCTGAGGTTGAGGGGCATGCCCGAACAGTTCTGCGGCTACATTGCTCACTTATACGATACGGCGTCCACCACCTTAGCCGTGAACAATGAAATGAGCAGCCCTGTGAAAGTGGGACGAGGGGTTCGTCAAGGGGACCCTCTGTCGCCAATACTCTTCAACGTGGTGATGGACCTCATCCTAGCTTCCCTGCCGGAGGGTCGGGTATAG
Protein
MMVKRRWHGEEVDLLARTEARLLAERGQCSGGDLFGALPGFGRTLEAIKGQRRREPYRALVQAHLARFGSQPGPSSGGCSTEPDFRRASGAEDAGEERCAEDAAAYDPSAVGQMSPDAARVLSELLEGAGRRRACRAMRPKTAGRRNDLHDDRTASAHKTRRQKRRAEYARVQELYKKCRSRAAAEVIDGACGGVGHSLEEMETYWRPILERVSDAPGPTPEALHALGREERHGGNRDYTQLWKPISVEEIKASRFDWRTSPGPDGIRSGQWRAVPVHLKAEMFNAWMARGEIPEILRQCRTVFVPKVERPGGPGEYRPISIASIPLRHFHSILARRLLACCPPDARQRGFICADGTLENSAVLDAVLGDSRKKLRECHVAVLDFAKAFDTVSHEALVELLRLRGMPEQFCGYIAHLYDTASTTLAVNNEMSSPVKVGRGVRQGDPLSPILFNVVMDLILASLPEGRV

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Keywords
Endonuclease   Hydrolase   Nuclease   Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  Retrovirus-related Pol polyprotein from type-1 retrotransposable element R2
Pfam
PF00078   RVT_1
Interpro
IPR013087   Znf_C2H2_type        + More
IPR000477   RT_dom       
PDB
6AR3     E-value=0.0747548,     Score=85

Ontologies

Topology

Length:
468
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.02751
Exp number, first 60 AAs:
0.00129
Total prob of N-in:
0.01195
outside
1  -  468
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号