SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06301
Pre Gene Modal
BGIBMGA001832
Annotation
Transposon_Tf2-8_polyprotein_[Thelohanellus_kitauei]
Location in the cell
Nuclear   Reliability : 4.007
 

Sequence

CDS
ATGGATAAATACAATCCAGATACATTCAGAATTGACGATTACATTGATTTTTTCGAAAACAAATGCAAAATTCTTGATATCGATAACAGCGACTTACAGAAAGATTTGCTTCTGAATTTACTAACACCAGAGATATTTCACGAATTAAAAGTAGCTTTAACGCCTGATTTCGATATAGCTACATACAGCGAAATTTGTAACAAATTATTAGACCTCTATCGCATAAAAACGACGAGGTATAGAGCCTTAACAGAATTTTGGAATTGCACTAGAGAACAAAATGAAACGATGGAACACTATGCAAACAGATTAAAAGGTCTTAGTCGGGATTGTGGCTACACTAATGACTTCCTGGAACGACAATTACGTGACCGCTTTGCCACTGGATTGAATCATCCAGATTTAGAAACCGACTTGAAACAAAAATGGCCTGATTTAGTTCAAATGGTAGACGGAATACCAAGAGAAGTAACCTTCCAACAAATTTTTACAATCTCTCAATCAAGAGAACAAGCAGAACAAGACACACCACGAACAAGTATTAAAAAAATAACAAGACCTCATAAGTCCTCAACATCATCATCATCATTTATCAGTAATAACGAGGAAGAAAGCGATGATGAAGTTATCTGCAGCGTCTTGGGTACACGTAAGAGAGAATGCAAACAAATCGATGTACGGATCAATGGCATACCTTGCACTATGGATTGGGACCCCGGCTCTGCGTATTCAATAATAAACACGACATTGTGGAAAAAATTAGGATCACCATCTTTACAACCCGCCCCGAAACTTAAGGCCTACGGCAACACAAACTTAAAAACAAAGGGAATTACAAAAGTGACAGTCGAAGTCGACGGACTGCAAAAACTTCTACCTGTGGTCGTAATGAAAAATGCCAAACCAATGTTATTTGGTTTACATTGGAGTGAAGTTTTTGAAATGGAATTTCCAAAACCAGTATACTCCATCAAAACATCAATACCGATTACTCTTAAACAAATACTGGATAAACATTCACAACTCTTTGATGGAAAACTAGGAAAAGTTAACAATTATTACGTAAACATACATGTCAAACCAGAAGCTGAACCGATCCACCTTCCTGCACGGCCTATAAAATTCAGCATGAAAAAGAATATAGAAAGGGAGATAGATCGTCTGATCTCAGAAGGGATAGTGGAAAAAGTAGATCCTAATATTACACCTATTGAATGGGCTACACCCACAGTTAACATTCTGAAATCTACAGGGGAAGTTAGGATATGTGGAGACTACAGAACTACACTTAATCCAGTACTTATTAAACATCTACACCCAGTTCCAATTTTCGATCAACTACGCCAAAATCTCGCAAACGGTAAATTATTTTCAAAAATAGACCTTAAAGACGCATACTTACAATTTGAAATAGCACCGGATTCGAAAAAGTACTTGACGTTGTCAACACATAAAGGGTATTTCCAATACAATAGAATGCCTTTTGGAATATCGACTGCTCCTTCAATTTTCCAACATTTTCTGGATCAACTGCTAGGCGATATCACCAATGTAGCTGTATATTTTGACGACATAGCTATAGCAGGGAAAGATCTTTCAGAACATTTACAAACTTTATCTATTGTATTCGATCGCTTACAAAACGCTGGCCTAAAAGTTAATTTAAAGAAATGTAATTTCTTACAGAATCAGATTGAATACCTAGGTCACATAATAGATAAACATGGCATCCACCCAACCAAATCTAAAATTGATGCCATAACTAAGGCTCCAGCACCGTGTAATGCAAAAGAACTACGATCATTTTTAGGACTAGTTAATTTTTACGAACGGTTTGTATCACACCTTCACGGGATTTGTTCGGATCTTCACGATCTAACTAGTGAAAAAAATAGATGGCGTTGGACTGATCATGAAAACAGAATATTTGAAGATACAAAGAAATGCATAACTTCTTCACAACCATTAATTGCATTTGACGAGAAACGTCCCCTTTATTTAGCATGTGACGCTTCCGAAAAGGGATTGGGTGCAGTATTATTCCACAAGGACTCGAACATAGAACAACCAATTGCTTTTGCTTCAAGGAAACTACGTCCAGCGGAAATGAAATATTCCGTTATTGATCGTGAAGCTTTAGCAATAGTATTTGGTATAAAAAAATTTGATCAGTACTTGAGAGGAACGAAATTTAATCTAGTTACGGACCATAAGCCTCTTATACATATTATGGGTGCACACCGCAACCTTCCTAAACTAGCCAATAACCGATTGGTAAGATGGGCCCTAGTAGTGGGAAGTTATCAATATGATATTTACTACAGGAAAGGTGAAAATAACACATTAGCTGATTGCCTTTCCAGATTACCAAACCCTGAAACTGAACCCTCCGAGACAGAAGGGCTTGTACATAAAATAGATCTACGTCTTTTGAGCACTCGAATGACTGACCTTAATCTATCAGAACAGTTACTTATGAAAACAACTTCAAAGGATCATATACTCACAAAAGTTTGTCAAAATTTAAAAACCGGCTGGAGAGAATCAGATTACAATCCAGAAATGAAACCATTCTACAGAAACCGGACTGAATTATCTGTTGAGAATAAGATACTTATGAGGCAAGGACGCATCGTTATACCTACAGCACTCCGAAAAGCCATTCTTACATACCTTCATCGAGGACATCCTGGCATTTCTGCTATGAAAGCACTTTCACGTTACTATGTTTGGTGGCCTAACCTTGACGAAGACATAGAATTATTTGTCAAGAAATGTACCAGATGCCAACAGAACCGCCCTTGTAATCCTGAACTTCCTGTATTTTCCTGGTCCATACCAGAAGAGGTATGGGAGAGAATCCATATCGACTTTGCTGGACCGTTCGAAGGATCGTATTGGTTGGTATTGTGCGACGCTCTCTCCAAATGGGTGGAAATACGATCGATGAAACACATCAACACCAGATCACTTTGTCTTACATTAGATAACATATTTTGTACATTTGGCTTACCAAAAATGATTATATCCGATAATGGACCTCAATTTACATCTTATGAATTTAAAGAATATTGCACAAAACAATCTATTTTACATGTCACATCATCTCCATATCATCCTCGAACAAATGGGCTGGCAGAACGTTTAGTCAGAACATTCAAAAATAGAATGGCATCGGTAGACAACACAAATCTCGAGCGCCGACTATTAGAATTTTTGTTTACATACAGAAACACTCCGCACTCGTCCACTGGTAAATCTCCAGCTGAGATGATGTTTGGACGACAATTGAATTGCATACTTTCCAACATTCGGCCAGACAAAAGAAGATTAATGCAGTATTTACAAGTAAAAGAAAACATTCGTACCACATCACCGAGTTACCGACCAAGTGACCAAGTATATATTAAAACACGCAATGATAAAATATGGGAACCAGCGGTAATTACATCCCGTAAACATAAATATTCATATATTGTTTCAACACCAGGAGGACTAGAAAAACGAAGACACGCTGATCACATCAGGCCACGCGAGTCCTCCACCTCAGAAACCCCGAGGAATGAAAGGGCGCATTCTTCTATGCTGCCGGCGACTGCTTCTCCAGACATTGGAATGGACACAACAATTGACGAAAGGCTAACTAAAAACAAGAATTCGGCAGCAGTACCATTACCTACACCGCAGTCACCTACAAATGTACAAATTTCTCCAAATTCACCTTCACAGCATTCGAAGTTATACTCCTCACCTGCTCCGGTCTCCACTCCTGTGCCATTTGCTCCGCGTCGAAGAAACGAAATAGTAACTATGGTGGAGCCATCAATTTACAAGTTTACCACAGCTGAAGGGGGTGCTCGTCTCGCTGCAATTGCATCTGAACGTAACACCCTTGCTGTGGAATACTCAAATTTCATTGCAACCAGGCTGGTCTATGAAGAAGCTTATAAGATACGAGGGTCGCTCTATGATAATAAGCAGAGATCAGTGCACGTGACAAGAGAGGATCGTATAAAATGCACCGCCTACGATCTGAGGATTATGACCGACTTGTCGTTGTGTGAGGCTGAGAAATACGATGATGTGTATGATTGGTACGCGGAACTTGATAAGAAAGAAGTTTTGGTCTGCACTTCAGTAGTTTTAAAACGAATTCTAGAAGAGGGAATAATATCAATGGCGAATATTAATGTTCTAATAATTGATAGCTGTCATTTAATAGTGACCGACGAGAATTTGAAATATATTATGCAAGTTTACAAAGATAGCGAAGAATCAAAAAGACCCCGAATACTTTCGTTGACATATCCTCTCTTTGGATCGCACAAAAAATCTGAAGACATTCATAATGACAAACAGGCAGATAACTCTGAGGATTCAAACAAAAGAGACTCATGTAATTTGAAAGATATGCTGATAGAAGAAGATAAACATGATAATGAAAGGTCAGAAAAAGATATGAGACACTCTCAAACTGATTCACCGAATGAAATTACTTGCGACAGTGACATTGGATCTTTGAAAGATACAAAAACAGACCTAGAACAGGATATAGTTGCTGAAGATAAATCATTAGAGAGCGAAAATATCGATGATTTCGATATGTATGAGAAGTTGGAGTGGAAAATTGAGCAACTGGAGAATGAGTTGTGCTGTAAAATGGATCTTGCTGAAGACATCGACACAGGGAAAAGAACAGCGGCGGCATCCACCAAACCAAATGAGCTGATAGTCGAATACTGTCCTCGGAGACCTGATAGCGAGCTCTCAGAGGATTACTTGGAGCTGGAGAGCTACATGAAGAGGACCGTTGAAGACGTCGCGGAGTTTGTTAATGATCACAGACACGATCCCACCGAGATATACGGAGACGAGCTGTACGAGGAGTTCAAGAACATTCCGGACCCGACGAACGAACCCAAAATGATGTTCAAACAGTTCTTACATGTTCTAGAAGAACTGGGTCCTTACGCAGCCGACAAAGCGGCCTTTTCGATATTAACGAAATTAGAGAAGTTAAAAATTAAAGTGCCGTACGAACGACATTTCCTCTTGTTGTGCCTCTGCACGACCGTGTTCGTCAGGATACGATGTTACGCGGACCTCGTGTTCGGGAAGCTGGAGTCGGACTGGGACCGAATCCGGGCCTTCTCGACGCCGAAAATACTGAGGTTGGCCGAAATATTAGAGAGGTTTCGGCCGCCCGATACACCTCACGACGAAGGCAAGAGGAACGGCCTCGCTCAAAACGAAGCCGCCGCCAACTCGAAGGATTCGTGCGCCGAAACATCGAGTTGCATAACGGAAAGCGAAAGCTCTAGCACCATCACTAGTAATTCGAGTTTACGTACCGACAGCGGACATGTGATTCTCGAGTCTGGCAATACCGACAAAGAAAATTTTGCCAGTTTAAATAACGCAGTTAATGTAGTCGCTGACCTGTGCGGTTCTACAGAGAATGTTAAGAACGGTGACAATGGCGGGCGTCTAAATAACACAAGCCCAAATGAAACCGATAATACACAAGTGAAGACCGAGCCTGATGAAGAAAAAATCAAATCGAAAACCCTCGAATTACTGAGTGCTATAGAAAAATGTGATTTCGCGTATTTAGCCGATAGGATAGAAGATAAAGTCAACGCTTACGAAGCTAACCTGAAAGAGATAGACGTTTACATCGACAAGTGCGATAGAGACGGGGATAGCGAACCGAATGAGACCGGGGCACAGGAAGAGAGAAAGTCGTCATATTGTAACGAAAAGATCCCCCAGCCTCACCTAGATCCGCTCCAGGTCAAACCGAGTCCTCTCAGACGTTCCGGGAATCGCGTCAGAGGCAGGACCAAACTCAGGAACAACGCCAATCGAACCCAAAACACGGGACAGAATCCTGACGCCCTGTGTGGCGTTTTATTCGTCAAGGAACCGCTTATGGCCAAAATTCTCTTCATGATTATCGCGGACCTGTCCCGTTGTCATCCGAAGTTATCGTACGTGTGCGCCCAGTACTGTGCAGTAGAGAACCCTGAAGAGTCCCTAGAGCCCAGAGAGTGCCAGCGACAGAATAAGAAACACGAAGATGTTCTCAAGAAGTTCCGGATGCACGAGTGCAACCTGCTGCTGGCCACGGCGGCGCTGGAGGAGGGCATCGACCTGCCGCGCTGCAACCTCGTGCTGAGATGGGACGCGCCGCCCTCGTCAGTATACTTCTGTTTCTGCTCCGCTTTGATGTGA
Protein
MDKYNPDTFRIDDYIDFFENKCKILDIDNSDLQKDLLLNLLTPEIFHELKVALTPDFDIATYSEICNKLLDLYRIKTTRYRALTEFWNCTREQNETMEHYANRLKGLSRDCGYTNDFLERQLRDRFATGLNHPDLETDLKQKWPDLVQMVDGIPREVTFQQIFTISQSREQAEQDTPRTSIKKITRPHKSSTSSSSFISNNEEESDDEVICSVLGTRKRECKQIDVRINGIPCTMDWDPGSAYSIINTTLWKKLGSPSLQPAPKLKAYGNTNLKTKGITKVTVEVDGLQKLLPVVVMKNAKPMLFGLHWSEVFEMEFPKPVYSIKTSIPITLKQILDKHSQLFDGKLGKVNNYYVNIHVKPEAEPIHLPARPIKFSMKKNIEREIDRLISEGIVEKVDPNITPIEWATPTVNILKSTGEVRICGDYRTTLNPVLIKHLHPVPIFDQLRQNLANGKLFSKIDLKDAYLQFEIAPDSKKYLTLSTHKGYFQYNRMPFGISTAPSIFQHFLDQLLGDITNVAVYFDDIAIAGKDLSEHLQTLSIVFDRLQNAGLKVNLKKCNFLQNQIEYLGHIIDKHGIHPTKSKIDAITKAPAPCNAKELRSFLGLVNFYERFVSHLHGICSDLHDLTSEKNRWRWTDHENRIFEDTKKCITSSQPLIAFDEKRPLYLACDASEKGLGAVLFHKDSNIEQPIAFASRKLRPAEMKYSVIDREALAIVFGIKKFDQYLRGTKFNLVTDHKPLIHIMGAHRNLPKLANNRLVRWALVVGSYQYDIYYRKGENNTLADCLSRLPNPETEPSETEGLVHKIDLRLLSTRMTDLNLSEQLLMKTTSKDHILTKVCQNLKTGWRESDYNPEMKPFYRNRTELSVENKILMRQGRIVIPTALRKAILTYLHRGHPGISAMKALSRYYVWWPNLDEDIELFVKKCTRCQQNRPCNPELPVFSWSIPEEVWERIHIDFAGPFEGSYWLVLCDALSKWVEIRSMKHINTRSLCLTLDNIFCTFGLPKMIISDNGPQFTSYEFKEYCTKQSILHVTSSPYHPRTNGLAERLVRTFKNRMASVDNTNLERRLLEFLFTYRNTPHSSTGKSPAEMMFGRQLNCILSNIRPDKRRLMQYLQVKENIRTTSPSYRPSDQVYIKTRNDKIWEPAVITSRKHKYSYIVSTPGGLEKRRHADHIRPRESSTSETPRNERAHSSMLPATASPDIGMDTTIDERLTKNKNSAAVPLPTPQSPTNVQISPNSPSQHSKLYSSPAPVSTPVPFAPRRRNEIVTMVEPSIYKFTTAEGGARLAAIASERNTLAVEYSNFIATRLVYEEAYKIRGSLYDNKQRSVHVTREDRIKCTAYDLRIMTDLSLCEAEKYDDVYDWYAELDKKEVLVCTSVVLKRILEEGIISMANINVLIIDSCHLIVTDENLKYIMQVYKDSEESKRPRILSLTYPLFGSHKKSEDIHNDKQADNSEDSNKRDSCNLKDMLIEEDKHDNERSEKDMRHSQTDSPNEITCDSDIGSLKDTKTDLEQDIVAEDKSLESENIDDFDMYEKLEWKIEQLENELCCKMDLAEDIDTGKRTAAASTKPNELIVEYCPRRPDSELSEDYLELESYMKRTVEDVAEFVNDHRHDPTEIYGDELYEEFKNIPDPTNEPKMMFKQFLHVLEELGPYAADKAAFSILTKLEKLKIKVPYERHFLLLCLCTTVFVRIRCYADLVFGKLESDWDRIRAFSTPKILRLAEILERFRPPDTPHDEGKRNGLAQNEAAANSKDSCAETSSCITESESSSTITSNSSLRTDSGHVILESGNTDKENFASLNNAVNVVADLCGSTENVKNGDNGGRLNNTSPNETDNTQVKTEPDEEKIKSKTLELLSAIEKCDFAYLADRIEDKVNAYEANLKEIDVYIDKCDRDGDSEPNETGAQEERKSSYCNEKIPQPHLDPLQVKPSPLRRSGNRVRGRTKLRNNANRTQNTGQNPDALCGVLFVKEPLMAKILFMIIADLSRCHPKLSYVCAQYCAVENPEESLEPRECQRQNKKHEDVLKKFRMHECNLLLATAALEEGIDLPRCNLVLRWDAPPSSVYFCFCSALM

Summary

Uniprot
ProteinModelPortal
PDB
4OL8     E-value=2.23756e-53,     Score=535

Ontologies

Topology

Length:
2077
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01053
Exp number, first 60 AAs:
0.00017
Total prob of N-in:
0.00003
outside
1  -  2077
 
 

Population Genetic Test Statistics

Pi
27.418248
Theta
195.02596
Tajima's D
0.64593
CLR
0.652923
CSRT
0.55837208139593
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号