SGID The Silkworm Genome Information Database
Gene
KWMTBOMO06290
Pre Gene Modal
BGIBMGA001827
Annotation
PREDICTED:_probable_RNA-binding_protein_orb2_isoform_X2_[Bombyx_mori]
Full name
Translational regulator orb2      
Location in the cell
Nuclear   Reliability : 1.28
 

Sequence

CDS
ATGTGCGTGAGTGCGCTCGGATCGCCGGCGCGATCGTCACCAGTGTCCGCCGGTTCTGAGCACGGCGAGCGATTTAGCCGTAAAGTATTTGTCGGCGGATTGCCACCAGACATCGACGAAGACGAGATAACGTCTTCGTTTCGTCGCTTCGGGCCGCTGGTGGTAGACTGGCCTCACAAGGCTGAGAGCAAAAGCTATTTTCCGCCCAAGGGTTACGCTTTTCTGCTGTTTCAAGATGAAAGTTCGGTGGCTGCTTTGATGGAAGCGTGCATCACCGACGAGGACAAGCTGTACCTGTGTGTGTCGTCACCGACCATCCGCGACAAGCCGGTCCAGATCCGACCGTGGCGGCTGGCGGACGCTGACTTCGTACTGGACGCAAGCATGCCGCTCGACCCGAGGAAGACCGTCTTCGTGGGAGGTGTTCCGCGTCCACTTAAAGCCGTCGAGCTTGCGATGATCATGGACCGGCTGTACGGTGGAGTTTGCTATGCCGGAATCGACACTGACCCGGAACTCAAATACCCGAAGGGCGCCGGACGGGTTGCGTTTTCGAACCAGCAGTCATACATAGCGGCCATCTCGGCGCGGTTCGTGCAGCTGCAGCACGGCGACATTGACAAGCGCGTCGAGGTGAAGCCGTACGTGTTGGACGACCAGATGTGTGACGAGTGCGCCGGAGCGCGGTGCGGCTCGAAGTTTGCGCCGTTCTTTTGCGCCAACGTCACTTGTCTACAGTATTATTGCGAGCACTGCTGGGCGACGATTCACTCTCGGCCCGGGCGCGAGTTCCACAAGCCGCTGGTGAAGGAGGGCGCCGACCGACCGCGCGCCGTGCCCTTTCGCTGGTGTTAA
Protein
MCVSALGSPARSSPVSAGSEHGERFSRKVFVGGLPPDIDEDEITSSFRRFGPLVVDWPHKAESKSYFPPKGYAFLLFQDESSVAALMEACITDEDKLYLCVSSPTIRDKPVQIRPWRLADADFVLDASMPLDPRKTVFVGGVPRPLKAVELAMIMDRLYGGVCYAGIDTDPELKYPKGAGRVAFSNQQSYIAAISARFVQLQHGDIDKRVEVKPYVLDDQMCDECAGARCGSKFAPFFCANVTCLQYYCEHCWATIHSRPGREFHKPLVKEGADRPRAVPFRWC

Summary

Description
Required in mushroom body gamma neurons for long-term memory in male courtship (PubMed:17965711, PubMed:23083740). Binds to mRNA 3'-UTRs (PubMed:20547833, PubMed:26638074, PubMed:24830287, PubMed:26095367). In its monomeric form, acts as a translational repressor of genes involved in neuronal growth, synapse formation and protein turnover (PubMed:20547833, PubMed:26638074). In its amyloid-like oligomeric form, acts as a translational activator (PubMed:26638074). The monomeric form reduces poly(A) tail length and destabilizes mRNA while the oligomeric form protects and elongates the poly(A) tail and stabilizes mRNA (PubMed:26638074). Isoform A is required for initial memory acquisition and, following subsequent late dopaminergic pathway activation, isoform A recruits isoform B into a complex to activate translation of CaMKII which is required for long-term memory consolidation (PubMed:26095367). Involved in asymmetric cell division in the central nervous system (PubMed:21900268). Required for the progression of spermatogenesis through meiosis and for sperm differentiation (PubMed:23209437). During sperm differentiation, required to asymmetrically localize and activate the translation of protein kinase aPKC mRNAs which is necessary for spermatid cyst polarization (PubMed:24830287). Also required during spermatid cyst polarization for localization and translation of its own mRNA (PubMed:24830287).
Subunit
Monomer (PubMed:22284910, PubMed:23083740). Upon neuronal stimulation, forms stable amyloid-like oligomers composed of isoform A and isoform B which are required for formation of persistent long-term memory (PubMed:22284910, PubMed:23083740). Isoform A is critical for oligomer formation (PubMed:22284910, PubMed:23083740). Phe-5 of isoform A is required for amyloid-like oligomerization (PubMed:22284910, PubMed:26812143). Rapidly forms amyloids and toxic intermediates are extremely transient (PubMed:26812143). Interacts with the translational regulator bol (PubMed:23209437). Interacts with Tob; the interaction is enhanced by neuronal stimulation, stabilizes isoform A and induces oligomerization (PubMed:24523662).
Similarity
Belongs to the tubulin family.
Keywords
Activator   Alternative splicing   Amyloid   Cell cycle   Cell division   Cell junction   Cell projection   Complete proteome   Cytoplasm   Differentiation   Phosphoprotein   Reference proteome   Repeat   Repressor   RNA-binding   Spermatogenesis   Synapse   Translation regulation  
Feature
chain  Translational regulator orb2
splice variant  In isoform A.
EMBL
BABH01021331    BABH01021332    KQ460555    KPJ14018.1    NWSH01001207    PCG72124.1    + More
PCG72125.1    PCG72123.1    AGBW02009112    OWR51647.1    KZ150163    PZC72680.1    PCG72122.1    GEBQ01014767    JAT25210.1    GEBQ01021361    JAT18616.1    GECZ01007077    JAS62692.1    GALX01003131    JAB65335.1    GBHO01004751    GBRD01000493    GDHC01020596    JAG38853.1    JAG65328.1    JAP98032.1    JXJN01018860    JXJN01018861    GBHO01028319    GBRD01000492    GDHC01004689    JAG15285.1    JAG65329.1    JAQ13940.1    CCAG010001198    GDHC01018640    JAP99988.1    ADTU01000965    ADTU01000966    ADTU01000967    ADTU01000968    ADTU01000969    ADTU01000970    ADTU01000971    ADTU01000972    ADTU01000973    ADTU01000974    KQ971307    KYB29628.1    KYB29629.1    ABLF02035406    ABLF02035419    ABLF02035420    DS235339    EEB14957.1    GEDC01005329    JAS31969.1    GFXV01007136    MBW18941.1    GEZM01075687    JAV64015.1    GDHF01018755    JAI33559.1    GECZ01016482    JAS53287.1    GBXI01004841    GBXI01000367    JAD09451.1    JAD13925.1    GAMC01012662    JAB93893.1    KQ434999    KZC13357.1    JH431443    GBYB01004155    JAG73922.1    CVRI01000064    CRL05158.1    GEDC01003673    JAS33625.1    HACA01019097    HACA01019098    CDW36459.1    GEBQ01015825    JAT24152.1    KQ977989    KYM98321.1    GFDF01008154    JAV05930.1    GALX01003132    JAB65334.1    QOIP01000005    RLU22408.1    AJVK01004017    AJVK01004018    KK107293    EZA53226.1    UFQS01000065    UFQT01000065    SSW98946.1    SSX19328.1    GL448317    EFN84808.1    GL443122    EFN62539.1    GL761587    EFZ23098.1    KQ435876    KOX70129.1    GECZ01014395    JAS55374.1    GECU01004618    JAT03089.1    APGK01039143    KB740967    KB632399    ENN76859.1    ERL94653.1    KQ979039    KYN23289.1    GL888002    EGI69228.1    KQ976598    KYM79545.1    KQ981855    KYN34919.1    KK121552    KFM80707.1    CH902618    KPU78138.1    KQ982736    KYQ51447.1    GDKW01003790    JAI52805.1    GBBI01002218    JAC16494.1    KZ288234    PBC31436.1    GBGD01001944    JAC86945.1    GEDV01003775    JAP84782.1    CH379070    KRT08778.1    CH933809    KRG05828.1    CH479208    EDW31175.1    GACK01003266    JAA61768.1    NCKU01004105    RWS06441.1    CH954178    KQS43394.1    AE014296    AAF50351.1    AAN11975.1    AGB94303.1    AY052043    AY060352    AAF50350.1    AAK93467.1    GGLE01006829    MBY10955.1    KQ760478    OAD60228.1    GBYB01004157    JAG73924.1    GBYB01004156    JAG73923.1    JR040096    AEY58976.1    JR040095    AEY58975.1    LJIJ01000509    ODM96707.1    OUUW01000002    SPP76733.1    AAZX01001314    CM000159    KRK00946.1    LNIX01000006    OXA52839.1    GG666476    EEN66481.1    CM002912    KMY98509.1    KQS43395.1    ABJB010446084    DS814574    EEC11315.1    BT099773    ACV88432.1    KQ422034    KOF75640.1    KMY98511.1    KQ414590    KOC70389.1   
Pfam
PF16367   RRM_7        + More
PF16366   CEBP_ZZ
PF03953   Tubulin_C
PF00091   Tubulin
Interpro
IPR012677   Nucleotide-bd_a/b_plait_sf        + More
IPR038446   CEBP_ZZ_sf       
IPR034819   CPEB       
IPR000504   RRM_dom       
IPR032296   CEBP_ZZ       
IPR035979   RBD_domain_sf       
IPR017975   Tubulin_CS       
IPR018357   Hexapep_transf_CS       
IPR003008   Tubulin_FtsZ_GTPase       
IPR008280   Tub_FtsZ_C       
IPR000217   Tubulin       
IPR018316   Tubulin/FtsZ_2-layer-sand-dom       
IPR036525   Tubulin/FtsZ_GTPase_sf       
IPR004057   Epsilon_tubulin       
IPR038104   Rap1_C_sf       
SUPFAM
SSF54928   SSF54928        + More
SSF52490   SSF52490       
SSF55307   SSF55307       
PDB
2MKJ     E-value=1.77989e-102,     Score=950

Ontologies

Topology

Subcellular location
Perikaryon   In embryonic and larval nervous system, concentrated in the perikaryon (PubMed:21900268). In the adult central nervous system, localizes to synaptic terminals (PubMed:21900268). In the ovary, localizes to the cytoplasm of nurse cells (PubMed:21900268). In spermatocytes, localizes throughout the cytoplasm with higher levels concentrated in a ring around the nucleus (PubMed:23209437). The oligomeric form is enriched in the synaptic region (PubMed:22284910).   With evidence from 8 publications.
Cell projection   In embryonic and larval nervous system, concentrated in the perikaryon (PubMed:21900268). In the adult central nervous system, localizes to synaptic terminals (PubMed:21900268). In the ovary, localizes to the cytoplasm of nurse cells (PubMed:21900268). In spermatocytes, localizes throughout the cytoplasm with higher levels concentrated in a ring around the nucleus (PubMed:23209437). The oligomeric form is enriched in the synaptic region (PubMed:22284910).   With evidence from 8 publications.
Axon   In embryonic and larval nervous system, concentrated in the perikaryon (PubMed:21900268). In the adult central nervous system, localizes to synaptic terminals (PubMed:21900268). In the ovary, localizes to the cytoplasm of nurse cells (PubMed:21900268). In spermatocytes, localizes throughout the cytoplasm with higher levels concentrated in a ring around the nucleus (PubMed:23209437). The oligomeric form is enriched in the synaptic region (PubMed:22284910).   With evidence from 8 publications.
Dendrite   In embryonic and larval nervous system, concentrated in the perikaryon (PubMed:21900268). In the adult central nervous system, localizes to synaptic terminals (PubMed:21900268). In the ovary, localizes to the cytoplasm of nurse cells (PubMed:21900268). In spermatocytes, localizes throughout the cytoplasm with higher levels concentrated in a ring around the nucleus (PubMed:23209437). The oligomeric form is enriched in the synaptic region (PubMed:22284910).   With evidence from 8 publications.
Cell junction   In embryonic and larval nervous system, concentrated in the perikaryon (PubMed:21900268). In the adult central nervous system, localizes to synaptic terminals (PubMed:21900268). In the ovary, localizes to the cytoplasm of nurse cells (PubMed:21900268). In spermatocytes, localizes throughout the cytoplasm with higher levels concentrated in a ring around the nucleus (PubMed:23209437). The oligomeric form is enriched in the synaptic region (PubMed:22284910).   With evidence from 8 publications.
Synapse   In embryonic and larval nervous system, concentrated in the perikaryon (PubMed:21900268). In the adult central nervous system, localizes to synaptic terminals (PubMed:21900268). In the ovary, localizes to the cytoplasm of nurse cells (PubMed:21900268). In spermatocytes, localizes throughout the cytoplasm with higher levels concentrated in a ring around the nucleus (PubMed:23209437). The oligomeric form is enriched in the synaptic region (PubMed:22284910).   With evidence from 8 publications.
Cytoplasm   In embryonic and larval nervous system, concentrated in the perikaryon (PubMed:21900268). In the adult central nervous system, localizes to synaptic terminals (PubMed:21900268). In the ovary, localizes to the cytoplasm of nurse cells (PubMed:21900268). In spermatocytes, localizes throughout the cytoplasm with higher levels concentrated in a ring around the nucleus (PubMed:23209437). The oligomeric form is enriched in the synaptic region (PubMed:22284910).   With evidence from 8 publications.
Perinuclear region   In embryonic and larval nervous system, concentrated in the perikaryon (PubMed:21900268). In the adult central nervous system, localizes to synaptic terminals (PubMed:21900268). In the ovary, localizes to the cytoplasm of nurse cells (PubMed:21900268). In spermatocytes, localizes throughout the cytoplasm with higher levels concentrated in a ring around the nucleus (PubMed:23209437). The oligomeric form is enriched in the synaptic region (PubMed:22284910).   With evidence from 8 publications.
  
Length:
284
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00277
Exp number, first 60 AAs:
0
Total prob of N-in:
0.01074
outside
1  -  284
 
 

Population Genetic Test Statistics

Pi
205.658312
Theta
169.030003
Tajima's D
0.581639
CLR
0.616721
CSRT
0.542272886355682
Interpretation
Uncertain
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号

渝公网安备 50010602502065号