Silkworm Genome Informatics Database

Gene

KWMTBOMO06290

Pre Gene Modal

BGIBMGA001827

Annotation

PREDICTED:_probable_RNA-binding_protein_orb2_isoform_X2_[Bombyx_mori]

Location

Bomo_Chr11(+):4049101-4115483 View in EpiBrowser

Full name

Translational regulator orb2

Location in the cell

Nuclear Reliability : 1.28

CDS

ATGTGCGTGAGTGCGCTCGGATCGCCGGCGCGATCGTCACCAGTGTCCGCCGGTTCTGAGCACGGCGAGCGATTTAGCCGTAAAGTATTTGTCGGCGGATTGCCACCAGACATCGACGAAGACGAGATAACGTCTTCGTTTCGTCGCTTCGGGCCGCTGGTGGTAGACTGGCCTCACAAGGCTGAGAGCAAAAGCTATTTTCCGCCCAAGGGTTACGCTTTTCTGCTGTTTCAAGATGAAAGTTCGGTGGCTGCTTTGATGGAAGCGTGCATCACCGACGAGGACAAGCTGTACCTGTGTGTGTCGTCACCGACCATCCGCGACAAGCCGGTCCAGATCCGACCGTGGCGGCTGGCGGACGCTGACTTCGTACTGGACGCAAGCATGCCGCTCGACCCGAGGAAGACCGTCTTCGTGGGAGGTGTTCCGCGTCCACTTAAAGCCGTCGAGCTTGCGATGATCATGGACCGGCTGTACGGTGGAGTTTGCTATGCCGGAATCGACACTGACCCGGAACTCAAATACCCGAAGGGCGCCGGACGGGTTGCGTTTTCGAACCAGCAGTCATACATAGCGGCCATCTCGGCGCGGTTCGTGCAGCTGCAGCACGGCGACATTGACAAGCGCGTCGAGGTGAAGCCGTACGTGTTGGACGACCAGATGTGTGACGAGTGCGCCGGAGCGCGGTGCGGCTCGAAGTTTGCGCCGTTCTTTTGCGCCAACGTCACTTGTCTACAGTATTATTGCGAGCACTGCTGGGCGACGATTCACTCTCGGCCCGGGCGCGAGTTCCACAAGCCGCTGGTGAAGGAGGGCGCCGACCGACCGCGCGCCGTGCCCTTTCGCTGGTGTTAA

Protein

MCVSALGSPARSSPVSAGSEHGERFSRKVFVGGLPPDIDEDEITSSFRRFGPLVVDWPHKAESKSYFPPKGYAFLLFQDESSVAALMEACITDEDKLYLCVSSPTIRDKPVQIRPWRLADADFVLDASMPLDPRKTVFVGGVPRPLKAVELAMIMDRLYGGVCYAGIDTDPELKYPKGAGRVAFSNQQSYIAAISARFVQLQHGDIDKRVEVKPYVLDDQMCDECAGARCGSKFAPFFCANVTCLQYYCEHCWATIHSRPGREFHKPLVKEGADRPRAVPFRWC

Description

Required in mushroom body gamma neurons for long-term memory in male courtship (PubMed:17965711, PubMed:23083740). Binds to mRNA 3'-UTRs (PubMed:20547833, PubMed:26638074, PubMed:24830287, PubMed:26095367). In its monomeric form, acts as a translational repressor of genes involved in neuronal growth, synapse formation and protein turnover (PubMed:20547833, PubMed:26638074). In its amyloid-like oligomeric form, acts as a translational activator (PubMed:26638074). The monomeric form reduces poly(A) tail length and destabilizes mRNA while the oligomeric form protects and elongates the poly(A) tail and stabilizes mRNA (PubMed:26638074). Isoform A is required for initial memory acquisition and, following subsequent late dopaminergic pathway activation, isoform A recruits isoform B into a complex to activate translation of CaMKII which is required for long-term memory consolidation (PubMed:26095367). Involved in asymmetric cell division in the central nervous system (PubMed:21900268). Required for the progression of spermatogenesis through meiosis and for sperm differentiation (PubMed:23209437). During sperm differentiation, required to asymmetrically localize and activate the translation of protein kinase aPKC mRNAs which is necessary for spermatid cyst polarization (PubMed:24830287). Also required during spermatid cyst polarization for localization and translation of its own mRNA (PubMed:24830287).

Subunit

Monomer (PubMed:22284910, PubMed:23083740). Upon neuronal stimulation, forms stable amyloid-like oligomers composed of isoform A and isoform B which are required for formation of persistent long-term memory (PubMed:22284910, PubMed:23083740). Isoform A is critical for oligomer formation (PubMed:22284910, PubMed:23083740). Phe-5 of isoform A is required for amyloid-like oligomerization (PubMed:22284910, PubMed:26812143). Rapidly forms amyloids and toxic intermediates are extremely transient (PubMed:26812143). Interacts with the translational regulator bol (PubMed:23209437). Interacts with Tob; the interaction is enhanced by neuronal stimulation, stabilizes isoform A and induces oligomerization (PubMed:24523662).

Similarity

Belongs to the tubulin family.

Keywords

Activator Alternative splicing Amyloid Cell cycle Cell division Cell junction Cell projection Complete proteome Cytoplasm Differentiation Phosphoprotein Reference proteome Repeat Repressor RNA-binding Spermatogenesis Synapse Translation regulation

Feature

chain Translational regulator orb2
splice variant In isoform A.

Uniprot

H9IX44 A0A0N1PG59 A0A2A4JKJ6 A0A2A4JJ51 A0A2A4JL09 A0A212FD55 + More
A0A2W1BIV3 A0A2A4JL34 A0A1B6LN86 A0A1B6L4N0 A0A1B6GJR2 A0A1A9WPX8 V5G5I5 A0A0A9Z680 A0A1B0BQY7 A0A0A9XDW1 A0A1B0GAW7 A0A1A9ZTR0 A0A1A9XQJ4 A0A146KVU7 A0A158ND92 A0A139WNN7 A0A139WNQ9 A0A1I8PQP0 J9K1V8 E0VNK1 A0A1B6E239 A0A2H8TYS7 A0A1Y1KWG0 A0A0K8V3T0 A0A1B6FSU8 A0A0A1XSR0 W8BA20 A0A154PNQ3 T1ISN3 A0A1A9V4J0 A0A0C9R7Z4 A0A1J1J144 A0A1B6E6T4 A0A0K2UDY0 A0A1B6LKC3 A0A151ID38 A0A1L8DHU4 V5GMK6 A0A3L8DRJ2 A0A1B0D8A6 A0A026WC34 A0A336K200 E2BHM4 E2AVI8 E9I8K1 A0A0M8ZV24 A0A1B6FYW8 A0A1B6JV50 N6T9D3 A0A195EEL5 F4W946 A0A195B5J2 A0A195F4A8 A0A087UTL8 A0A0P8XTT4 A0A151WUK8 A0A0P4VNV7 A0A023F5P6 A0A2A3EJS8 A0A069DSP3 A0A131Z1V8 A0A0R3P6E8 A0A1W4VCW5 A0A0Q9XKI1 B4H460 L7MET2 A0A3S3RY41 A0A0Q5UI00 A4V1P2 Q9VSR3 A0A2R5LNC5 A0A1S3KDN3 A0A1S3KD60 A0A310SU20 A0A0C9QU00 A0A0C9RBA7 V9IER3 V9ID12 A0A1D2MUE3 A0A3B0J8U7 Q9VSR3-2 A0A1W4VC01 K7J6K5 A0A0R1E042 A0A226E5X8 C3XZT3 A0A0J9RT67 A0A088ACR5 A0A0Q5UF32 B7PXJ3 C8VV27 A0A0L8GGJ2 A0A0J9RRR1 A0A0L7RHU8

Pubmed

19121390 26354079 22118469 28756777 25401762 26823975 + More
21347285 18362917 19820115 20566863 28004739 25830018 24495485 30249741 24508170 20798317 21282665 23537049 21719571 17994087 27129103 25474469 26334808 26830274 15632085 25576852 10731132 12537568 12537572 12537573 12537574 16110336 17569856 17569867 26109357 26109356 12537569 17965711 18327897 20547833 21900268 22284910 23083740 23209437 24523662 24830287 26638074 26095367 26812143 27289101 20075255 17550304 18563158 22936249

EMBL

BABH01021331 BABH01021332 KQ460555 KPJ14018.1 NWSH01001207 PCG72124.1 + More
PCG72125.1 PCG72123.1 AGBW02009112 OWR51647.1 KZ150163 PZC72680.1 PCG72122.1 GEBQ01014767 JAT25210.1 GEBQ01021361 JAT18616.1 GECZ01007077 JAS62692.1 GALX01003131 JAB65335.1 GBHO01004751 GBRD01000493 GDHC01020596 JAG38853.1 JAG65328.1 JAP98032.1 JXJN01018860 JXJN01018861 GBHO01028319 GBRD01000492 GDHC01004689 JAG15285.1 JAG65329.1 JAQ13940.1 CCAG010001198 GDHC01018640 JAP99988.1 ADTU01000965 ADTU01000966 ADTU01000967 ADTU01000968 ADTU01000969 ADTU01000970 ADTU01000971 ADTU01000972 ADTU01000973 ADTU01000974 KQ971307 KYB29628.1 KYB29629.1 ABLF02035406 ABLF02035419 ABLF02035420 DS235339 EEB14957.1 GEDC01005329 JAS31969.1 GFXV01007136 MBW18941.1 GEZM01075687 JAV64015.1 GDHF01018755 JAI33559.1 GECZ01016482 JAS53287.1 GBXI01004841 GBXI01000367 JAD09451.1 JAD13925.1 GAMC01012662 JAB93893.1 KQ434999 KZC13357.1 JH431443 GBYB01004155 JAG73922.1 CVRI01000064 CRL05158.1 GEDC01003673 JAS33625.1 HACA01019097 HACA01019098 CDW36459.1 GEBQ01015825 JAT24152.1 KQ977989 KYM98321.1 GFDF01008154 JAV05930.1 GALX01003132 JAB65334.1 QOIP01000005 RLU22408.1 AJVK01004017 AJVK01004018 KK107293 EZA53226.1 UFQS01000065 UFQT01000065 SSW98946.1 SSX19328.1 GL448317 EFN84808.1 GL443122 EFN62539.1 GL761587 EFZ23098.1 KQ435876 KOX70129.1 GECZ01014395 JAS55374.1 GECU01004618 JAT03089.1 APGK01039143 KB740967 KB632399 ENN76859.1 ERL94653.1 KQ979039 KYN23289.1 GL888002 EGI69228.1 KQ976598 KYM79545.1 KQ981855 KYN34919.1 KK121552 KFM80707.1 CH902618 KPU78138.1 KQ982736 KYQ51447.1 GDKW01003790 JAI52805.1 GBBI01002218 JAC16494.1 KZ288234 PBC31436.1 GBGD01001944 JAC86945.1 GEDV01003775 JAP84782.1 CH379070 KRT08778.1 CH933809 KRG05828.1 CH479208 EDW31175.1 GACK01003266 JAA61768.1 NCKU01004105 RWS06441.1 CH954178 KQS43394.1 AE014296 AAF50351.1 AAN11975.1 AGB94303.1 AY052043 AY060352 AAF50350.1 AAK93467.1 GGLE01006829 MBY10955.1 KQ760478 OAD60228.1 GBYB01004157 JAG73924.1 GBYB01004156 JAG73923.1 JR040096 AEY58976.1 JR040095 AEY58975.1 LJIJ01000509 ODM96707.1 OUUW01000002 SPP76733.1 AAZX01001314 CM000159 KRK00946.1 LNIX01000006 OXA52839.1 GG666476 EEN66481.1 CM002912 KMY98509.1 KQS43395.1 ABJB010446084 DS814574 EEC11315.1 BT099773 ACV88432.1 KQ422034 KOF75640.1 KMY98511.1 KQ414590 KOC70389.1

Proteomes

UP000005204 UP000053240 UP000218220 UP000007151 UP000091820 UP000092460 + More
UP000092444 UP000092445 UP000092443 UP000005205 UP000007266 UP000095300 UP000007819 UP000009046 UP000076502 UP000078200 UP000183832 UP000078542 UP000279307 UP000092462 UP000053097 UP000008237 UP000000311 UP000053105 UP000019118 UP000030742 UP000078492 UP000007755 UP000078540 UP000078541 UP000054359 UP000007801 UP000075809 UP000242457 UP000001819 UP000192221 UP000009192 UP000008744 UP000285301 UP000008711 UP000000803 UP000085678 UP000094527 UP000268350 UP000002358 UP000002282 UP000198287 UP000001554 UP000005203 UP000001555 UP000053454 UP000053825

PRIDE

H9IX44 A4V1P2 Q9VSR3 C8VV27

Pfam

PF16367   RRM_7        + More
PF16366   CEBP_ZZ
PF03953   Tubulin_C
PF00091   Tubulin

Interpro

IPR012677   Nucleotide-bd_a/b_plait_sf        + More
IPR038446   CEBP_ZZ_sf
IPR034819   CPEB
IPR000504   RRM_dom
IPR032296   CEBP_ZZ
IPR035979   RBD_domain_sf
IPR017975   Tubulin_CS
IPR018357   Hexapep_transf_CS
IPR003008   Tubulin_FtsZ_GTPase
IPR008280   Tub_FtsZ_C
IPR000217   Tubulin
IPR018316   Tubulin/FtsZ_2-layer-sand-dom
IPR036525   Tubulin/FtsZ_GTPase_sf
IPR004057   Epsilon_tubulin
IPR038104   Rap1_C_sf

SUPFAM

SSF54928   SSF54928        + More
SSF52490   SSF52490
SSF55307   SSF55307

Gene 3D

3.30.40.130 3.30.70.330 3.40.50.1440 1.10.10.2170

ProteinModelPortal

H9IX44 A0A0N1PG59 A0A2A4JKJ6 A0A2A4JJ51 A0A2A4JL09 A0A212FD55 + More
A0A2W1BIV3 A0A2A4JL34 A0A1B6LN86 A0A1B6L4N0 A0A1B6GJR2 A0A1A9WPX8 V5G5I5 A0A0A9Z680 A0A1B0BQY7 A0A0A9XDW1 A0A1B0GAW7 A0A1A9ZTR0 A0A1A9XQJ4 A0A146KVU7 A0A158ND92 A0A139WNN7 A0A139WNQ9 A0A1I8PQP0 J9K1V8 E0VNK1 A0A1B6E239 A0A2H8TYS7 A0A1Y1KWG0 A0A0K8V3T0 A0A1B6FSU8 A0A0A1XSR0 W8BA20 A0A154PNQ3 T1ISN3 A0A1A9V4J0 A0A0C9R7Z4 A0A1J1J144 A0A1B6E6T4 A0A0K2UDY0 A0A1B6LKC3 A0A151ID38 A0A1L8DHU4 V5GMK6 A0A3L8DRJ2 A0A1B0D8A6 A0A026WC34 A0A336K200 E2BHM4 E2AVI8 E9I8K1 A0A0M8ZV24 A0A1B6FYW8 A0A1B6JV50 N6T9D3 A0A195EEL5 F4W946 A0A195B5J2 A0A195F4A8 A0A087UTL8 A0A0P8XTT4 A0A151WUK8 A0A0P4VNV7 A0A023F5P6 A0A2A3EJS8 A0A069DSP3 A0A131Z1V8 A0A0R3P6E8 A0A1W4VCW5 A0A0Q9XKI1 B4H460 L7MET2 A0A3S3RY41 A0A0Q5UI00 A4V1P2 Q9VSR3 A0A2R5LNC5 A0A1S3KDN3 A0A1S3KD60 A0A310SU20 A0A0C9QU00 A0A0C9RBA7 V9IER3 V9ID12 A0A1D2MUE3 A0A3B0J8U7 Q9VSR3-2 A0A1W4VC01 K7J6K5 A0A0R1E042 A0A226E5X8 C3XZT3 A0A0J9RT67 A0A088ACR5 A0A0Q5UF32 B7PXJ3 C8VV27 A0A0L8GGJ2 A0A0J9RRR1 A0A0L7RHU8

PDB

2MKJ E-value=1.77989e-102, Score=950

KEGG

101735954 K02602 cytoplasmic polyadenylation element-binding protein | (RefSeq) probable RNA-binding protein o

PATHWAY

04320 Dorso-ventral axis formation - Bombyx mori (domestic silkworm)

GO

GO:0045182 GO:0003730 GO:0045202 GO:0008135 GO:0043005 GO:2000766 GO:0043022 GO:0000900 GO:1990124 GO:0005737 GO:0005634 GO:0003723 GO:0007017 GO:0005874 GO:0016740 GO:0005525 GO:0003924 GO:0044297 GO:0048471 GO:0007288 GO:0043679 GO:0008049 GO:0007616 GO:0007141 GO:0044292 GO:0007291 GO:0008356 GO:0097060 GO:0008494 GO:0017148 GO:0030424 GO:0003729 GO:0030054 GO:0042802 GO:0005829 GO:0045727 GO:0043204 GO:0007283 GO:0003676 GO:0000166 GO:0008108 GO:0008270 GO:0008235 GO:0019538 GO:0030145 GO:0015923 GO:0006260

PANTHER

PTHR12566

Subcellular location

Perikaryon   In embryonic and larval nervous system, concentrated in the perikaryon (PubMed:21900268). In the adult central nervous system, localizes to synaptic terminals (PubMed:21900268). In the ovary, localizes to the cytoplasm of nurse cells (PubMed:21900268). In spermatocytes, localizes throughout the cytoplasm with higher levels concentrated in a ring around the nucleus (PubMed:23209437). The oligomeric form is enriched in the synaptic region (PubMed:22284910).   With evidence from 8 publications.
Cell projection   In embryonic and larval nervous system, concentrated in the perikaryon (PubMed:21900268). In the adult central nervous system, localizes to synaptic terminals (PubMed:21900268). In the ovary, localizes to the cytoplasm of nurse cells (PubMed:21900268). In spermatocytes, localizes throughout the cytoplasm with higher levels concentrated in a ring around the nucleus (PubMed:23209437). The oligomeric form is enriched in the synaptic region (PubMed:22284910).   With evidence from 8 publications.
Axon   In embryonic and larval nervous system, concentrated in the perikaryon (PubMed:21900268). In the adult central nervous system, localizes to synaptic terminals (PubMed:21900268). In the ovary, localizes to the cytoplasm of nurse cells (PubMed:21900268). In spermatocytes, localizes throughout the cytoplasm with higher levels concentrated in a ring around the nucleus (PubMed:23209437). The oligomeric form is enriched in the synaptic region (PubMed:22284910).   With evidence from 8 publications.
Dendrite   In embryonic and larval nervous system, concentrated in the perikaryon (PubMed:21900268). In the adult central nervous system, localizes to synaptic terminals (PubMed:21900268). In the ovary, localizes to the cytoplasm of nurse cells (PubMed:21900268). In spermatocytes, localizes throughout the cytoplasm with higher levels concentrated in a ring around the nucleus (PubMed:23209437). The oligomeric form is enriched in the synaptic region (PubMed:22284910).   With evidence from 8 publications.
Cell junction   In embryonic and larval nervous system, concentrated in the perikaryon (PubMed:21900268). In the adult central nervous system, localizes to synaptic terminals (PubMed:21900268). In the ovary, localizes to the cytoplasm of nurse cells (PubMed:21900268). In spermatocytes, localizes throughout the cytoplasm with higher levels concentrated in a ring around the nucleus (PubMed:23209437). The oligomeric form is enriched in the synaptic region (PubMed:22284910).   With evidence from 8 publications.
Synapse   In embryonic and larval nervous system, concentrated in the perikaryon (PubMed:21900268). In the adult central nervous system, localizes to synaptic terminals (PubMed:21900268). In the ovary, localizes to the cytoplasm of nurse cells (PubMed:21900268). In spermatocytes, localizes throughout the cytoplasm with higher levels concentrated in a ring around the nucleus (PubMed:23209437). The oligomeric form is enriched in the synaptic region (PubMed:22284910).   With evidence from 8 publications.
Cytoplasm   In embryonic and larval nervous system, concentrated in the perikaryon (PubMed:21900268). In the adult central nervous system, localizes to synaptic terminals (PubMed:21900268). In the ovary, localizes to the cytoplasm of nurse cells (PubMed:21900268). In spermatocytes, localizes throughout the cytoplasm with higher levels concentrated in a ring around the nucleus (PubMed:23209437). The oligomeric form is enriched in the synaptic region (PubMed:22284910).   With evidence from 8 publications.
Perinuclear region   In embryonic and larval nervous system, concentrated in the perikaryon (PubMed:21900268). In the adult central nervous system, localizes to synaptic terminals (PubMed:21900268). In the ovary, localizes to the cytoplasm of nurse cells (PubMed:21900268). In spermatocytes, localizes throughout the cytoplasm with higher levels concentrated in a ring around the nucleus (PubMed:23209437). The oligomeric form is enriched in the synaptic region (PubMed:22284910).   With evidence from 8 publications.

Length:

284

Number of predicted TMHs:

0

Exp number of AAs in TMHs:

0.00277

Exp number, first 60 AAs:

0

Total prob of N-in:

0.01074

outside

1 - 284

Pi

205.658312

Theta

169.030003

Tajima's D

0.581639

CLR

0.616721

CSRT

0.542272886355682

Interpretation

Uncertain

Sequence

Summary

Ontologies

Topology

Population Genetic Test Statistics