SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06286  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA001616
Annotation
PREDICTED:_guanine_nucleotide-binding_protein-like_1_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.122
 

Sequence

CDS
ATGCCCCAAGCACGTCGGAAGACCCCGTTCAGCGGGAAGGCCAAAAAACAACAACTGCAGTCTAAGAAGCAGAACAAGGTTTTACTCATGCCTACATCGACAGGAACAAATGCATACGATGTGGTCTCCGTCAACTACCAGCCGAGTCGTGGACGCGGAGGACGGGACACAAACAGATATGCTCTAAAATTCTACCGAGAAACTGAAGATGAACTTAAAATTAAAAAGGAAGATGCTCTGAGAGCTCTGAGTCCTGTTCCAGAGAAAGAAATGGAGATTAACTCCTTAGATTATTTTCCTGTCGACTTGTCCTTCCCTAGAAGACCACCGTGGGACTTTAATATGACAGCGGCACAATTAGATGCACAAGAGCATAGATATTTCAAGAACTACATAGATAAACTGCAAGCCTCGGAACAGTGGAAGGACATTTCCTATTTTGAAATGAATCTGGAGACATGGCGTCAATTGTGGAGGGTTTTAGAAATGTGTGACATTCTCCTTTTGATCGTCGATGTTAGATATGCTGGCATGATGTTTCCGCCGTCTCTATATGAATACATAGTGAAAGATCAACACAAGAATATGATAGTCGTAATGAATAAGATAGACTTGGTGCCGGCCGGCGTGGTCGCAGCCTGGAAGGAGTATTTCGTGGAGAAATATCCTGGATTGAGGGTAGTTTATTTCACTTCGTGCCCCAGCTACAATCTGAGGGGAGCATCAAGCGATAAAGCAGGTCTACAGGTCCGTCGTCGTAAAGGGAGACAGAGAATGTGTTCGGAAGGGGCCACGAAGATTCTAGAAGCATGCAAGGACATAGTCAACGGAGAAGTGGATCTTTCATCGTGGGAGAAGAAGATACGGGACGAGACGGAAATCGACTTTGACGAGGATGAAAAAGAGATTGGTGAAGCGATAATCCAGAAGGCCGACACCACGTACTTTGCTCACGAGCGGTACAGGAACGGCACGCTGACCGTCGGCTGCGTCGGCCAGCCCAACGTCGGCAAGTCCTCGCTTATGAACTCCGTGATGGGCCGCAAGGTGGTCTCCGTGTCGCGGACCCCGGGCCACACCAAGCACTTCCAGACCGTGTACCTGACGCCGCAGGTACGTCTCTGCGACTGTCCCGGGCTGGTGTTCCCGTCGAAGGTGCCTAGGCCCATACAGATCCTGATGGGTTCATATCCCATAGCCCAGCTCAGGGAGCCGTACACCGCCATAAGGTACTTGGGTGAGAGGCTAAACCTACCGCAGCTGTTGCGCATCGAGCACCCGGACAACGAGGACACGTGGTCGCCCTGGGACATCTGCGATGGCTGGGCGAAGAAACGCAGCTATCTGACAGCGAAATCTGCCAGATTGGACACGTACAGAGCAGCGAACAGCCTGCTCAGGATGGCGCTGGACGGTAGAATATGCCTTTGGCTGCGGCCTCCCGGCTACACTGAAAAAAAAGTTACATTGTTTTTTTTTATGAGTGGGGGGCTCCGCCCTTGGACTCCAATGGGGCGGAGCCCCCCGGACAGGGACAGGGACAGGGAAAGGGAAAGGGAAAGGGAAAGGGAAAGGGAAAGGGAAAGGGAAAGGGAAAGGGAAAGGGAAAGGGAAAGGGAAAGGGACAGGGACAGGGACAGGGACAGGGAAAGGGACAGGGACAGGGACAGGGACAGGGACAGGGAAAGGGACAGGGAAAGGGACAGGGACAGGGACAGGGAAATGGACAAGGACAGGGACAGGGACAGGAACAGGGACAGGGACAGGGACAGGGACAGGGACAGGGACAGGGACAGGGACAGGGACAGGGACAGGGACAGGGACAGGGACAGGGACAGGGACAGGGACAGGGACAGGGACAGGGACAGGGACAGGGACAGGGAAAGGGACACGGACACGGACACGGAGAGAGAGAGAGAGAGAGAGAAGTATTTCGAGAAGTGCGATGAGATAAAATACGTGAAGTGGGTCCAATCGTTGAGCGAAGGGGACGCTGGCGAGTCATCGCCCGTGGTCAGCAGCGACGCCGGCAGCGATCATGACGACACAGATGACAACGATGACGACGATGATGACGACGACGACAGCGCTGAGACGGCGGTGATGGCGAACAAGTTCTCTGCCCTCATTCAAGATTGA
Protein
MPQARRKTPFSGKAKKQQLQSKKQNKVLLMPTSTGTNAYDVVSVNYQPSRGRGGRDTNRYALKFYRETEDELKIKKEDALRALSPVPEKEMEINSLDYFPVDLSFPRRPPWDFNMTAAQLDAQEHRYFKNYIDKLQASEQWKDISYFEMNLETWRQLWRVLEMCDILLLIVDVRYAGMMFPPSLYEYIVKDQHKNMIVVMNKIDLVPAGVVAAWKEYFVEKYPGLRVVYFTSCPSYNLRGASSDKAGLQVRRRKGRQRMCSEGATKILEACKDIVNGEVDLSSWEKKIRDETEIDFDEDEKEIGEAIIQKADTTYFAHERYRNGTLTVGCVGQPNVGKSSLMNSVMGRKVVSVSRTPGHTKHFQTVYLTPQVRLCDCPGLVFPSKVPRPIQILMGSYPIAQLREPYTAIRYLGERLNLPQLLRIEHPDNEDTWSPWDICDGWAKKRSYLTAKSARLDTYRAANSLLRMALDGRICLWLRPPGYTEKKVTLFFFMSGGLRPWTPMGRSPPDRDRDRERERERERERERERERERERERERERDRDRDRDRERDRDRDRDRDRERDRERDRDRDREMDKDRDRDRNRDRDRDRDRDRDRDRDRDRDRDRDRDRDRDRDRDRDRDRDRDRERDTDTDTEREREREKYFEKCDEIKYVKWVQSLSEGDAGESSPVVSSDAGSDHDDTDDNDDDDDDDDDSAETAVMANKFSALIQD

Summary

Pfam
PF01926   MMR_HSR1
Interpro
IPR027417   P-loop_NTPase        + More
IPR030378   G_CP_dom       
IPR006073   GTP_binding_domain       
SUPFAM
SSF52540   SSF52540       
PDB
6N8O     E-value=9.52703e-39,     Score=405

Ontologies

Topology

Length:
712
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.2057
Exp number, first 60 AAs:
0.01064
Total prob of N-in:
0.00996
outside
1  -  712
 
 

Population Genetic Test Statistics

Pi
215.933832
Theta
135.409613
Tajima's D
2.600477
CLR
0.608348
CSRT
0.955402229888506
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号