SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06238  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA001635
Annotation
PREDICTED:_heat_shock_protein_68-like_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 4.227
 

Sequence

CDS
ATGCACTTCGGCGCGAGGGAAAACAGCAAGAACGGGCACAGGACCATTCTTTTTAAGGATCCCAAAAGAACACAAAATCGTGTAGGACTAAGTGAAATTGATCTGAGGAAAATCGAAGTCGTCTACGGACCTGAGTGCTTGAAGAGGGACAGACAAGCAAAGATCGATCTCTGTCAGTCTTACCCGGGTGTAGCCAGGAGGAAAAGAGACGTAAGAATCAGTGAAAGCCTACGAATCAATCCTGATATAACACCTTTCCCAAAGAACCTTAATATAAGCGAGAACGACGAAATTAATTCCACCATTATTGATGACGATTTAAAATCAACGTTAGACAAACTCGAAATTACTGATGAAATGGAAATATTGATAGAGGAAATACATACAGTTATAGACATGGCTGTATCAAGGGCCAAAACAAGACACTGCAATGGCACTACGAAACATAACAGTGTTCCTAAAATAAACGTGACTAATACAGATTTATCGGGAGCCGTTGAAATAATAACTAATTTGGTTATAAGTAACGTTGAAAACGCTTTGACGAGAAAAGATTTTTGCACGTCTAAGGACATTCCAATAGCCAGATGCGGTTATGGATCCGACGATAGATGTAGACAGACGTACAGATCCACGAAATCGGGTGCAGTTAAATATTCAACGCAACACAGACCTACTTATTACCAATCGACGAACCATTATCCTTTGTCGAGAATAAAACATTTGCTAAGATCCCAAGGTGATAAGAATACCACAGACGCAAAAGGATCGGATAGTATATCGGATGTGAATGTAGAAGCTAAAAAAGATAGAGTGAGAAAGAAAAGAAGTTTAGATGGAGACGTAGAAGAAGATAGTGTTAGGAAATCGGAAAAGGGTAGCGAAGAACCTGGAAATTTGTCTTCGAATCACGTTACTGAAGCTCTTGATGCCGCCTTGAAGAATGGAACTGGTGGTAGAATGTTTTTTAAGGCGCGACATTACAGCGTCAAGAGCAAAAATCAAATGTCGAATATAAATTGGGAGGATTCGAATTTGTCACTGGAGACGAACAGAAAAATTAGTACTAAGAAAAATGATCGAGAATATTCTCGAAACGTATTCACCGAAATGACTGAAGTTTATACTGAAAAGCAAACGAAGAAAAGGCTACGACAACAGAAACAGAAGGAAAAATCCGGTTCGAGATTCGCGCCGAAAACCGTCAGACTCACGAAGTTGAACAAAGAATTTTACGAGGACAGAAAATGGCCCTCCGGCGTCGTTAGATACGTCATAAAAGATAACGCGCAATACGATGTCCCCGGACTAAGGAGACGACTGGAAGAGGTTAACGAGATATTGATGGAGAAGACTTGTGTTAGAATACGCGAGCTATCCGAAGATGAAGTCGGCAAATACAAAGATTACCTCGTCATAGATGATAGTCCAGACTATGTGACCGGAAGAGTTGGGGGCAGACAGTTTTGTAACACGTATTTACAATTCGATCATCTCAAAATGGTGGCTATAGGCATCGATCTTGGGACTACGTATTCGTGTGTGGCTGTCTGGAGGCAAGGACACGTGGAAGTTATACCCAACGAGCAAGGTAATCGTTCAACTCCATCTTACGTAGCTTTCACAGAGACAGAACGACTTATAGGCGAGTGCGCTAAGAACCAAGCGGTTTTTAACCCGCGCAACACGGTTTTTAGCGCTAAGCGCTTGATCGGACGCCGCTACGACGATATCGGAGTCCAAATGGACCTACGGTATTGGCCATTCAATGTCGTCAATGAAAACGGTAAGCCAATTATATCGGTTACATACAAAAGCGGTACGAAGCGGTTCGCTCCTGAGGAAATAAGCAGTATGCTACTTTTCAGGATCAAGGAGATGGCCGAGGCGTATCTCGGGTGCGAAGTCGATAAAGCAGTGATCACTGTGCCTGCTTATTTCACGGACTCCCAACGTCAAGCCACTAGGACGGCTGGCGTCGTCGCTGGCTTTCAGGTCCTCAGGGTGACGAACGAGCCGACAGCAGCCGCCCTCGCCTACAGCATAGACAAGAAACTTAAAGGCAAAAAGATCTTAGTTTACGACTTAGGCGGTGGCACATTCGACGTTTCGATCCTGATCATCAAGGACGGTCCGGTGTATGAAGTGAAAGCGACAGCCGGCAACACTAGATTGGGCGGAGAGGATTTTGATAACAGATTAGTTGCATATTTCTCTGAGGATTTCCGCAAGCGGTTCAATATTGATATAACCAAGAATCCGAAGTCGTTGAGGAGACTCAAAACTGCTGCGGAGAGAGTTAAAAGGTTTCTCACTTCGGCCACTGAAGCAACAGTACAAGTCGAGTCCTTGTACGATGACATTGACTATGTCGGAAAGATTTCTCGGACCGTATTCGAAGAGCTATGCTCTGATTTATTCTACGACACGCTCAAGTTGATCGAGCAGGCTTTAGCCGATGCGAGGCTAAAGAAAAATGACATAAATCGTGTCATTCTGGTCGGAGGTAGCACGAGAATACCAAAGATACAGGAGATACTACATGAATACTTCGAAGGGAGGGTGTCGGCATGTCTGAATCCCGATGAGGCTGTAGCGCACGGAGCCGCCATCCAAGCAGCGATATTGAGTGGAGAACACGACGTTAACATCCGAGACCTGCACCTCGTTGACGTGGTCCCATTATCGCTCGGCGTCGAGACAGTCAGAGGAGTAATGTACAAAGTCATCGAACGAAATACATCTATACCCTGTCGAAGGACCAAAGACCTGACCACTCTAGATGACTACCAAAACAGCATGACAATCGAAGTTTTCGAAGGCGAACGAACGCTAACGAAGGACAACAGTTTACTTGGAGTATTCGATCTCCACGGCATTCCACCGGCTCCGAGAGGTGTCGCCAAAGTCGATGTCACATTCGATATAGACGCGAACGGCATCTTGAGCGTGACCGCGCGAGATCGGAGCACCGGTAACTGCAAGAGTATCACTATAAAGAACGAGAACAGAGTCTCTCAGCTGCAGATAGGGAAAATGATAGCAGATGCCGAAACTTACCGCGAAGAAGACAGGGAGAATCAACGGAGATTGGAGTGCAGGAACCAGCTCGAAACCTATATCTACGATGTTAAGAACAGAGCGGAGAATAGTCATGAATTAGGAGAAGAAGAACGCATGCAGATTAAGAAGGAATGTGAGAGCCCGGTGGAGTGGTTGGATGATAACGGGGATTGTTTGAGAGAAGAATTCGAACGGAAAATGACTGAGCTGATGAGGCAGTGGTCCGTTATAATGCAAAAATTGTGCGGTGGCTCTTTGAGACATATAGCGAAGAGACAGAGAAGCGAGAGCTACCAGAACTTTGGCAGCATTGAGCTGCTGCGCGGCGGCCAACATCGACAGCACACCGCCATGATGGTCATGGCGATGCTGGGCTTCTACTTCGAAGTGGCCCGTCACGACCGCGACCTTTACATTAAGGTTCACCCCAGACACATCAGACCCGATAAGCTCCATCATTTTGAGAAAATACGACCTGACGCCACGTTTGATTTGGCGTACGACTACAAAAGCGCCACACACCCGGCCTGGCAGTACTGGAGGCAAATAGGCAGGACCGGAATATCTTCGGTTGCGACCTACAAAGATCAGGATCCCGACGGCTCCATAATGCGTTCACTAGGCCAAAACGAAGAGCTGTTATCAGATATCGACATAATCAAGATAAACTCAGTGTATGGAGTCAAATTGCGACACATGAAACACAAATACAGCTTGGCTATAGCTATTGCTGTTTTAAAAACAAAACCCGAAAATGTTACAACGGACGAACATTTAGCAAATATTAAACAGAAAATAAACAGTGATGATGCTGACGATGATGATGATGTAACCGTGTGCAGTGATGATTTCGTTTTTGATGTTAACGATCCATCGGCTTCGCTAGTTGATATAAAAAATGACGGGCCAAGTCGTATTGATGACACGCTTCGAAGTTCAAACGAGACTTACTGCGAGAGTGGCCTTCGAGAAACTGCGAATGATAATAAACAATCGGATCATGGTAATATTACCGATCAACGAATCCTCGACAGCTTAGTGATTACCAATGAACTAACTAGCGATGACGTAGTTGTAATAAATAATCGAAAGTGTGACGACACGACCACTCTAAAATGTATCGATGGTAAAATTCGGGAATTAGCTAACGAGAATTCTAGTGTCGCGGCACCTATTAGCAAAGAAATCAATAACGCAATGATCATTGAAGAAAACAATCGTGACAGTGATAATGTTACAAGCGAACATCAAGTTTTTGATGCTCCTGCGTTCCAAAATGATCGAATTGAAGTTGGCCTTCAAAATAATTTCATATACCCTCAAAAACAAAATGAAGAGTTCTTAAGTGACGTCTTAAGAACTTTAAATGAACTGGACAATACAAGAGTCCTAGGCGATTTAATAGATAGATTGCACGAAGAAGAATTGTATCCTGAATTCTTAGAAGAACTACTGAATTACGTTGAACTTACAATAAAACGTATATACGAAGACAATGACTTTGATAACATCAGCAGCTCGCAGTCGCAGGACGACGAGAGGAGCTTAAAAAAGAGTTCCATTACCGAAATATGGCGCAAGAAATGGATACCGAACTACGGGGATGTAGTAAGCACAAGTGACGTCACCGAGAAAGTGTGCATCGAAATTAGATGCAGCGAAGTTCTGAACAAAATAGTCGTTGGCTGTATGGACGGTTACAGTTTGCTGTCGTATTCAGCTTTGAAATGTTTCAATCTATTGCAGCCTTAA
Protein
MHFGARENSKNGHRTILFKDPKRTQNRVGLSEIDLRKIEVVYGPECLKRDRQAKIDLCQSYPGVARRKRDVRISESLRINPDITPFPKNLNISENDEINSTIIDDDLKSTLDKLEITDEMEILIEEIHTVIDMAVSRAKTRHCNGTTKHNSVPKINVTNTDLSGAVEIITNLVISNVENALTRKDFCTSKDIPIARCGYGSDDRCRQTYRSTKSGAVKYSTQHRPTYYQSTNHYPLSRIKHLLRSQGDKNTTDAKGSDSISDVNVEAKKDRVRKKRSLDGDVEEDSVRKSEKGSEEPGNLSSNHVTEALDAALKNGTGGRMFFKARHYSVKSKNQMSNINWEDSNLSLETNRKISTKKNDREYSRNVFTEMTEVYTEKQTKKRLRQQKQKEKSGSRFAPKTVRLTKLNKEFYEDRKWPSGVVRYVIKDNAQYDVPGLRRRLEEVNEILMEKTCVRIRELSEDEVGKYKDYLVIDDSPDYVTGRVGGRQFCNTYLQFDHLKMVAIGIDLGTTYSCVAVWRQGHVEVIPNEQGNRSTPSYVAFTETERLIGECAKNQAVFNPRNTVFSAKRLIGRRYDDIGVQMDLRYWPFNVVNENGKPIISVTYKSGTKRFAPEEISSMLLFRIKEMAEAYLGCEVDKAVITVPAYFTDSQRQATRTAGVVAGFQVLRVTNEPTAAALAYSIDKKLKGKKILVYDLGGGTFDVSILIIKDGPVYEVKATAGNTRLGGEDFDNRLVAYFSEDFRKRFNIDITKNPKSLRRLKTAAERVKRFLTSATEATVQVESLYDDIDYVGKISRTVFEELCSDLFYDTLKLIEQALADARLKKNDINRVILVGGSTRIPKIQEILHEYFEGRVSACLNPDEAVAHGAAIQAAILSGEHDVNIRDLHLVDVVPLSLGVETVRGVMYKVIERNTSIPCRRTKDLTTLDDYQNSMTIEVFEGERTLTKDNSLLGVFDLHGIPPAPRGVAKVDVTFDIDANGILSVTARDRSTGNCKSITIKNENRVSQLQIGKMIADAETYREEDRENQRRLECRNQLETYIYDVKNRAENSHELGEEERMQIKKECESPVEWLDDNGDCLREEFERKMTELMRQWSVIMQKLCGGSLRHIAKRQRSESYQNFGSIELLRGGQHRQHTAMMVMAMLGFYFEVARHDRDLYIKVHPRHIRPDKLHHFEKIRPDATFDLAYDYKSATHPAWQYWRQIGRTGISSVATYKDQDPDGSIMRSLGQNEELLSDIDIIKINSVYGVKLRHMKHKYSLAIAIAVLKTKPENVTTDEHLANIKQKINSDDADDDDDVTVCSDDFVFDVNDPSASLVDIKNDGPSRIDDTLRSSNETYCESGLRETANDNKQSDHGNITDQRILDSLVITNELTSDDVVVINNRKCDDTTTLKCIDGKIRELANENSSVAAPISKEINNAMIIEENNRDSDNVTSEHQVFDAPAFQNDRIEVGLQNNFIYPQKQNEEFLSDVLRTLNELDNTRVLGDLIDRLHEEELYPEFLEELLNYVELTIKRIYEDNDFDNISSSQSQDDERSLKKSSITEIWRKKWIPNYGDVVSTSDVTEKVCIEIRCSEVLNKIVVGCMDGYSLLSYSALKCFNLLQP

Summary

Uniprot
ProteinModelPortal

Ontologies

Topology

Length:
1604
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01193
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00004
outside
1  -  1604
 
 

Population Genetic Test Statistics

Pi
257.652464
Theta
176.316824
Tajima's D
1.394702
CLR
0.090325
CSRT
0.760061996900155
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
26822097 VATETSIR 100.00 3e-06
26822097 IRPDATFDIAYDYK 100.00 0.004
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号