SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06233  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA001639
Annotation
PREDICTED:_probable_Xaa-Pro_aminopeptidase_P_[Papilio_xuthus]
Full name
Xaa-Pro aminopeptidase ApepP      
Alternative Name
Aminopeptidase P
Location in the cell
PlasmaMembrane   Reliability : 2.268
 

Sequence

CDS
ATGGCCCGTGCCTTCGTTCTAATTATATGGTGTTTATGTTTCAGTATATCTCGATGTCATATTCCTAATAATTATTACGATTCGGCCGAGAGTGTTGCACCGGTGGCAGTGCTTCCCGGAAATGTAACAAAGTTGACTCGTTCCGAGAGTCAAGAGCGTCTCAGGGCAGTGCGACTTGTCTTGGCTTCTAGAGCAGTCGACGCATACATCGTGCCCACAGCTGATGCCCATAACTCGCAATACATAGCGCCTTCTGATGCTCGCCGAGAATGGGTGTCGGGTCTGCGTGGCTCGTCTGGTACTTCGGTGGTGACCGCCACCAGAGCTTTAGTCTGGACAGACGCTAGATACTTCACGCAGTTCGAAGTGGAAGTAGACGGGAGTCTTTGGGAGCTGATGAGGCAAGGCACCGATCCCTCGATCCAAAATTGGTTAGTTGCGAATATGCCACCGAACTCTGTAGTTGCTGTCGACCCAACTACGTACACCAGAAACTCATGGAACACTCTCCAGGCGGCACTAACTCGAGCCAACATCAAATTAGAAGCAATATCTGAAAATTTAATAGACTTGGCCAGAGTTAGTATTGGTGATGGTCCTCCGAGCCGACCTAACAATCCATTGATTCCTCTGACCGTGAACTTTACTGGTCGACCTTCGAGTGACAAAATCTCGCAACTGCTTCAACAAATGAATTCAAGAGGCGCCTCCGCTTTGGTCCTGACAGCCCTCGATGATATAGCCTACACACTAAATCTCCGTGGTACTGATATACCGTTTAATCCGGTGTTCTTTGCCTATTTGGTCATCAGAACGGATCTGGTAGCACCGAACAATATTATTCTGTTCTGGGGCAACGGAGTTCTGTCGTCAGACATATCACAGCACTTGGCTTCAGAGAACACCCGATTACAGGCAAGACCGTATGCAGAAATCTTCACGTATCTCGGTACGTTGGCGTCCGAAGTATCCGGTAGGAGTATCTGGTTGTCCGATGACGCGAGCCACGCTGTCTATTCTGCGGTTGAAAGTGCCTCAAACGTTAACATTCAGTCTTCTGTATCTCCTGTAGCCTTGATGAAGGTTATCAAGAATGAAGTCGAATTGCAGGGCTTCCGTAACGCACATGTCAAAGATGGCGTAGCTGTGGTAAGGGCGCTCTACTGGCTTCACCGGCAGTTGGACACTGGAGCCGAGGTCACCGAGGTCGGCTTGGTAAACAAACTCGCTGAATACAGGAGTGAAGAAACCGACTCCATGGGTCCTTCGTTTTCGACTATCGCCGGCGCCGGAGAGAATGGTGCGATAATACACTACAGTCCTCTGAGCGAGGGTCCTCAGAGAGTGATCACCAAGGATGACATGGTTCTGGTTGATTCAGGAGGGCAATACAAAGATGGCACCACCGATATCACCAGGACCCGGCACATGAACTCTTCCCCAACTCCTGAACAGCGTCGAGCGTTCACAAGGGTCATGAAGGGACAGATCGCTCTGGGAACTGCCGTCTTGCCAGCAGGCATATTGGGTCACACAATTGAGGTGCTGGCCCGCAAGGCGCTTTGGGACATCGGCCTCAACTATGGTCACGGGACGGGTCACGGCGTGGGACACTACCTCAACGTGCACGAGGCACCGGCCTGGATCCTCAGTGCAGTCTCGGTTGATGACCCTGGCATCAGACCAAACATGATATACAGTAATGAACCCGGGTACTACGAAGTAGGGGAGTACGGGATTCGCCACGAAGATCTGGTCCAGACTATCGAGATGAACAGCAGCGCTGATCATGTACTGGTACGTGAGCATTCGATGTACTGTAAACAAAATTGA
Protein
MARAFVLIIWCLCFSISRCHIPNNYYDSAESVAPVAVLPGNVTKLTRSESQERLRAVRLVLASRAVDAYIVPTADAHNSQYIAPSDARREWVSGLRGSSGTSVVTATRALVWTDARYFTQFEVEVDGSLWELMRQGTDPSIQNWLVANMPPNSVVAVDPTTYTRNSWNTLQAALTRANIKLEAISENLIDLARVSIGDGPPSRPNNPLIPLTVNFTGRPSSDKISQLLQQMNSRGASALVLTALDDIAYTLNLRGTDIPFNPVFFAYLVIRTDLVAPNNIILFWGNGVLSSDISQHLASENTRLQARPYAEIFTYLGTLASEVSGRSIWLSDDASHAVYSAVESASNVNIQSSVSPVALMKVIKNEVELQGFRNAHVKDGVAVVRALYWLHRQLDTGAEVTEVGLVNKLAEYRSEETDSMGPSFSTIAGAGENGAIIHYSPLSEGPQRVITKDDMVLVDSGGQYKDGTTDITRTRHMNSSPTPEQRRAFTRVMKGQIALGTAVLPAGILGHTIEVLARKALWDIGLNYGHGTGHGVGHYLNVHEAPAWILSAVSVDDPGIRPNMIYSNEPGYYEVGEYGIRHEDLVQTIEMNSSADHVLVREHSMYCKQN

Summary

Description
Catalyzes the removal of a penultimate prolyl residue from the N-termini of peptides, such as Arg-Pro-Pro.
Catalytic Activity
Release of any N-terminal amino acid, including proline, that is linked to proline, even from a dipeptide or tripeptide.
Cofactor
Mn(2+)
Biophysicochemical Properties
Optimum pH is 7.6.
Similarity
Belongs to the peptidase M24B family.
Keywords
Aminopeptidase   Complete proteome   Cytoplasm   Hydrolase   Manganese   Metal-binding   Protease   Reference proteome  
Feature
chain  Xaa-Pro aminopeptidase ApepP
EC Number
3.4.11.9
EMBL
NWSH01001426    PCG71273.1    JF262040    ADZ74177.1    KQ459463    KPJ00495.1    + More
ODYU01008066    SOQ51348.1    KZ150382    PZC71089.1    KPJ00479.1    NWSH01000280    PCG77804.1    BABH01021246    KZ150245    PZC71878.1    KQ459920    KPJ19323.1    GEZM01029634    JAV86027.1    KQ971343    EFA04188.1    GGFK01006280    MBW39601.1    GGFJ01003395    MBW52536.1    GGFK01006293    MBW39614.1    GDIP01239376    JAI84025.1    GDIP01238077    JAI85324.1    LRGB01000512    KZS18524.1    CP012525    ALC44134.1    GDIQ01148334    JAL03392.1    GGFJ01003396    MBW52537.1    GDIP01196076    GDIP01081431    JAJ27326.1    GDIP01107138    JAL96576.1    GDIP01125689    JAL78025.1    GDIP01058753    JAM44962.1    GDIP01229272    JAI94129.1    GDIP01038153    JAM65562.1    GDIP01215680    JAJ07722.1    CH477612    EAT38334.1    GDIP01040200    JAM63515.1    GDIP01041094    JAM62621.1    EAT38333.1    ADMH02000792    ETN65044.1    GGFM01002936    MBW23687.1    AXCN02001401    GDIQ01156763    JAK94962.1    GDIQ01145525    GDIQ01093087    GDIQ01030273    JAL58639.1    GDIQ01158765    JAK92960.1    GDIQ01108886    GDIQ01052418    JAN42319.1    GDIP01104536    JAL99178.1    GDIQ01152570    JAK99155.1    GAKP01022691    JAC36261.1    GDIQ01191342    GDIQ01036630    JAK60383.1    GDIQ01195106    JAK56619.1    GDIQ01088145    GDIQ01086396    JAN06592.1    GFDL01000869    JAV34176.1    GDIQ01155365    JAK96360.1    GDIQ01090633    JAN04104.1    GDIP01094597    JAM09118.1    GAMD01003444    JAA98146.1    GDIQ01229144    JAK22581.1    GL732530    EFX86469.1    GANO01001581    JAB58290.1    AXCM01002320    UFQT01001441    SSX30595.1    UFQT01002456    SSX33509.1    SSX30594.1    SSX33508.1    KA646762    AFP61391.1    CM002910    KMY90641.1    AY082012    AE014134    AY061297    AAL28845.1    AAL99293.1    AJ131920    CAA10526.2    GDHF01009720    JAI42594.1    GBXI01001615    JAD12677.1    AAAB01008811    EAL41692.4    GAPW01000577    JAC13021.1    GEDC01028978    JAS08320.1    APCN01004825    CM000361    EDX05285.1    CH954179    EDV54874.1    GFDF01001142    JAV12942.1    LJIG01022812    KRT78593.1    GFDF01001143    JAV12941.1    GFDG01001277    JAV17522.1    GFDG01001283    JAV17516.1    GDIP01047684    JAM56031.1    GFDG01001280    JAV17519.1    GFDG01001281    JAV17518.1    CH902620    EDV30956.1    CVRI01000054    CRL00590.1    GFDG01001282    JAV17517.1    LNIX01000003    OXA57386.1    NEVH01021955    PNF19004.1   
Pfam
PF01321   Creatinase_N        + More
PF16188   Peptidase_M24_C
PF00557   Peptidase_M24
Interpro
IPR000587   Creatinase_N        + More
IPR000994   Pept_M24       
IPR029149   Creatin/AminoP/Spt16_NTD       
IPR032416   Peptidase_M24_C       
IPR036005   Creatinase/aminopeptidase-like       
IPR033740   Pept_M24B       
IPR001131   Peptidase_M24B_aminopep-P_CS       
SUPFAM
SSF55920   SSF55920        + More
SSF53092   SSF53092       
Gene 3D
PDB
3CTZ     E-value=3.17488e-107,     Score=995

Ontologies

Topology

Subcellular location
Cytoplasm  
SignalP
Position:   1 - 19,         Likelihood:  0.981929
 
 
Length:
610
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.167
Exp number, first 60 AAs:
0.09112
Total prob of N-in:
0.00653
outside
1  -  610
 
 

Population Genetic Test Statistics

Pi
228.24743
Theta
168.874019
Tajima's D
1.197278
CLR
0.775049
CSRT
0.709114544272786
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
28556443 QLDTGAEVTEVGLVNK 100.00 3e-05
28556443 DFLLKPEILR 100.00 3e-05
28556443 GSSGTSVVTATR 100.00 6e-04
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号