SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06198
Pre Gene Modal
BGIBMGA007302
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 1.134 Mitochondrial   Reliability : 1.319 Nuclear   Reliability : 1.675
 

Sequence

CDS
ATGTCATGCAATCCGACTGACCCCCGGCGCCATAGTGATCCCGGGTCACATGGTGGGAAGTATGCTACCGGCCACTGTACTGTAGACCACCAGGTAGGCAGTGGAAACTATGCAACTGGTGATGGTACTGGTAAAAGTAAAACCCAACTGAGAAAATATTTGCGTATGGGAACTTGGAATGTGAGAGGAATGTTGAAACCGGGTAAGCAAGAAGTCATCGAGAGGGAGATGTTAAGGTGCAAAATCGACATATTGGGGCTAAGTGAAGTTCATAGAAGAGGCAGCGGTCATATAAAAACTGCTAACGGGAACATCTTGTACTTTTCGGGATCGGAAAATCATAGTGGTAATGGAGTTGCTATACTTTTACCACAGAAACTTGAAAGCAGCGTGTTAGGATACAAAACACCAAGTGATCGTATTATTGCTGTTAAACTTGATGCGCGCCCCGTACCTATCAACATTGTCCAGGTGTATGCACCAACCTCCCAATCTGAAGAAATTATATCTGACCAATTCTATTTTGAATTGGATGACTTGTTGCGTACTGTTCCATCTGGGGAGGTGACTGTTGTGTACGGCGATTGGAACGCGAAGGTTGGTACCACTAGAGGTGATGTATTACTCGGAGCAACAGTCGGAAACTTTGGACTTGGTGTGAGGAATGACAGAGGTGAAAAATTTCTTCAATTCTGCGTGGAAAATCAGCTGGTCATCATGAACACCTGGTTTGAACACCACCCGAGAAGGTTATATACTTGGATATCGCCATGTGGACATCGGAACCAGATTGATTATATTACCATCAAGTCTAGGTGGCGATCTTCCGTATTGAATACTAAAACACTTCCTGGTGCCGACTGCGGAAGTGACCACCAGTTGGTGGTGGCAGACTTCAGACTTCGTTTAAAAGTCATCAAGCCAAAATTTCCTATCAATATAGAACTGAATAAGCCAGCGCTGGACCATTTTCATAAAACTGTAGACATGAATATACGATCAATGCTTTGGGATCCATGTGGTTCAAGTGAAGCTAACTGGAACAATCTGAAAAAGGTTGTACTGGATACGGCTAAACGAAGCAGAGATCTACACAAAGCAGTTCCTAAACATGAAGAATGGATTAGCAAGGAGTCATGGATGTTGATAGAGAAAAGGAAAAGACTAAAAGAACAAGGCATTGTAAACAATAGTCAAAGGGAGCGCTACAATCAATTGCATGCAGAGATTCAAAGGTCTACTCGGAGAGACAGAGATGAGCACATCAATAATATGTGTGAAGAAATTGAGGGACATGCTGATAAAGTGCAGACTAAGGACCTTTTCCTGAAAGTGAAGCAGCTAACGGGTGTCTTCAAGCCGAAGAAATGGATTATCGAAGATAGTAGAGGTAACACCTTGACAGAAATGGAACATGTTTTGGAGAGGTGGAGAAACTACTGTTATGACCTATATCGCGATGAAGATAATTTATGCACCGCCAAAATATGGGATGACCACCTGGAAGAGCCTCCTATACTACTTTCTGAGGTTGAATATGCAATACAAAAACTTAAGCATAAGGTGGTTGGTCCGGATGGCGTGTCGGCAGCGATGCTTCAAAGTCTCGGTTCAGAAGGGATAAACATTATCCATCAGATATGTACCAAGATCTGGAAAACAGGCCAATGGCCCAGTGATTGGACAAAATCTGCAATAGTACCACTTCATAAGAAGGGCTCCACAGCGAAGTGTGAGAACTACCGAACTCTGTCGCTCATGTCCCACGCGAGTAAAATACTCCTTCGCATAATAAACAGCAGACTATCAGCTTTCATAGACCACCAGATACCGAGAGAACAGACTGGTTTTGTAGCTGGAAAAGGAACTCGCGAGCAAATTTTGAACGTCCGAGTGCTCATTGAGAAATTTCGCGAGTTTAACAAGCCTCTGGTGCTATGCTTTATAGATTATGCGAAGGCGTTTGACTGTGTTCGGTGGAGTAGCATGTTTGATGTGTTAATTGATATGGGCGTTCCTTCTCATCTCACACTATTGATACGGAATCTGTACCTTGATGGTTCTTGCTTCGTGAAACTGGATAATCGAGGATCTAAACCCTTCCATACAGAACGTGGAGTACGTCAGGGCTGCATTCTGTCACCCAAATTATTTAATATCTACGGCGAATACATAATGAGAAGAGCACTTGAGGGCTGGAATGGCGGTATTTCCGTGGGCGGTGAAACACTCACGAACCTGAGATACGCTGACGACACTACCATGCTTGCATCAGATGAGGAGGAAATGGCAATTCTGCTGAACCGTGTGGAAGAAGAAAGTGCTAAACTCGGTCTTAAAATCAACCACTCCAAGACCAAAATAATGATAATAGATAGAGCGCAACTTCTTCCACGTTCTGATGCACTCAGTGGCTACGAGAAAGTAGCAGAATTCATATATCTTGGGTCGCAAATAACATCCGAGGGTGGCTGCATGGGGGAGATACGCCGAAGATCCGGAATGGCTAAAAGTGCGATGGCCAATCTCAGGAAGATATGGAAAAATCGTAGCATCCGATGTATAACCAAAGTGCGCTTGGTGCGGGCACTGATCTTTCCCATATTCCTCTACGGGGCGGAGACATGGTGCATAAAAAGCCGGGATATCAAAAAGATCGATGCCTTTGAAATGTGGGTGTGGCGGAGGATGCTGCGAATACCGTGGACTGCCATGCGAACAAACGAGTCCATTCTAAGGCAGCTAGACATCCGAAAAAGGCTCTCTTCCATCTGCCGGGAACGTGTTATGAGCTTCTTCGGACACATCATGCGGTCTCCCAGACATGAATTAGAGAAGCTCATAATTACGGGTCGAATAGAAGGCAAGCGCGCCGTGGGCAGAACACCAGCCAGATGGTCAGATCTGGCAAGAGAAGCACTCGGTGGTAGTCTGTACCATGCAGTCCATGCCGCCCATGATCGGGTGCATTGGAAGTACATCGCATGTGGTCGCGATCCTCAGTAG
Protein
MSCNPTDPRRHSDPGSHGGKYATGHCTVDHQVGSGNYATGDGTGKSKTQLRKYLRMGTWNVRGMLKPGKQEVIEREMLRCKIDILGLSEVHRRGSGHIKTANGNILYFSGSENHSGNGVAILLPQKLESSVLGYKTPSDRIIAVKLDARPVPINIVQVYAPTSQSEEIISDQFYFELDDLLRTVPSGEVTVVYGDWNAKVGTTRGDVLLGATVGNFGLGVRNDRGEKFLQFCVENQLVIMNTWFEHHPRRLYTWISPCGHRNQIDYITIKSRWRSSVLNTKTLPGADCGSDHQLVVADFRLRLKVIKPKFPINIELNKPALDHFHKTVDMNIRSMLWDPCGSSEANWNNLKKVVLDTAKRSRDLHKAVPKHEEWISKESWMLIEKRKRLKEQGIVNNSQRERYNQLHAEIQRSTRRDRDEHINNMCEEIEGHADKVQTKDLFLKVKQLTGVFKPKKWIIEDSRGNTLTEMEHVLERWRNYCYDLYRDEDNLCTAKIWDDHLEEPPILLSEVEYAIQKLKHKVVGPDGVSAAMLQSLGSEGINIIHQICTKIWKTGQWPSDWTKSAIVPLHKKGSTAKCENYRTLSLMSHASKILLRIINSRLSAFIDHQIPREQTGFVAGKGTREQILNVRVLIEKFREFNKPLVLCFIDYAKAFDCVRWSSMFDVLIDMGVPSHLTLLIRNLYLDGSCFVKLDNRGSKPFHTERGVRQGCILSPKLFNIYGEYIMRRALEGWNGGISVGGETLTNLRYADDTTMLASDEEEMAILLNRVEEESAKLGLKINHSKTKIMIIDRAQLLPRSDALSGYEKVAEFIYLGSQITSEGGCMGEIRRRSGMAKSAMANLRKIWKNRSIRCITKVRLVRALIFPIFLYGAETWCIKSRDIKKIDAFEMWVWRRMLRIPWTAMRTNESILRQLDIRKRLSSICRERVMSFFGHIMRSPRHELEKLIITGRIEGKRAVGRTPARWSDLAREALGGSLYHAVHAAHDRVHWKYIACGRDPQ

Summary

EMBL
GU815090    ADF18553.1    FJ265546    ADI61814.1    FJ265548    ADI61816.1    + More
FJ265557    ADI61825.1    FJ265553    ADI61821.1    FJ265547    ADI61815.1    FJ265560    ADI61828.1    FJ265552    ADI61820.1    KZ150025    PZC74827.1    KZ150203    PZC72267.1    FJ265559    ADI61827.1    NCKU01004395    RWS06003.1    LBMM01007694    KMQ89503.1    NWSH01001998    PCG69477.1    GU815089    ADF18552.1    QIAP01000240    PYX61602.1    NEVH01017534    PNF24114.1    NEVH01023985    PNF17546.1    NEVH01022640    NEVH01008218    NEVH01005885    PNF18513.1    PNF34430.1    PNF38481.1    NEVH01002684    PNF41704.1    NEVH01015309    PNF27009.1    NEVH01002141    PNF42599.1    NEVH01019064    PNF23230.1    NEVH01019075    PNF22955.1    NEVH01014359    PNF27813.1    NEVH01025135    PNF15828.1    NEVH01013275    PNF29009.1    NEVH01019971    PNF22037.1    NEVH01023960    NEVH01010501    PNF17732.1    PNF32290.1    NEVH01014358    PNF27914.1    NEVH01018372    NEVH01014371    NEVH01011208    NEVH01002697    NEVH01002552    PNF23678.1    PNF27673.1    PNF31697.1    PNF41592.1    PNF42118.1    PNF27789.1    NEVH01017570    PNF23798.1    NEVH01007402    PNF35815.1    NEVH01013959    PNF28275.1    NEVH01003750    PNF40091.1    NEVH01012082    PNF31006.1    NEVH01021219    PNF19787.1    NEVH01005277    PNF39212.1    NEVH01020937    PNF20581.1    NEVH01017460    PNF24248.1    KF881087    AIJ27486.1    KF881086    AIJ27485.1    AHAT01017643    GFAH01000222    JAV48167.1    AHAT01008485    PDHN01000949    PGH37547.1    NEVH01021931    PNF19256.1    GDHC01007098    GDHC01001590    JAQ11531.1    JAQ17039.1    NEVH01021921    PNF19488.1    NEVH01025668    PNF15041.1    NEVH01016289    PNF26277.1    NEVH01017452    PNF24293.1    NEVH01013553    PNF28765.1    AAGJ04118689    AAGJ04161747    NEVH01006721    PNF37310.1    NEVH01011186    PNF32183.1    PNF37211.1    NEVH01016335    PNF25462.1    PNF37115.1    NEVH01003500    PNF40666.1    NEVH01020865    PNF20863.1    NEVH01013215    PNF29703.1    GGMR01018096    MBY30715.1    RQTK01002506    RUS68506.1    NEVH01021928    PNF19298.1    LSMT01001244    PFX12648.1    NEVH01017443    PNF24485.1    LSMT01000478    PFX17357.1    NEVH01027104    PNF13657.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF03372   Exo_endo_phos
Interpro
IPR005135   Endo/exonuclease/phosphatase        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR000477   RT_dom       
IPR002138   Pept_C14_p10       
IPR000637   HMGI/Y_DNA-bd_CS       
IPR027124   Swc5/CFDP2       
SUPFAM
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
1001
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.31747
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00027
outside
1  -  1001
 
 

Population Genetic Test Statistics

Pi
329.478364
Theta
188.958518
Tajima's D
3.80419
CLR
0.575505
CSRT
0.997550122493875
Interpretation
Possibly Balancing Selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号