SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06165
Pre Gene Modal
BGIBMGA009638
Annotation
PREDICTED:_uncharacterized_protein_LOC106131099_[Amyelois_transitella]
Location in the cell
Nuclear   Reliability : 4.023
 

Sequence

CDS
ATGTCTTATTTGGGAAATTTACCAATTTACGATCATAAAACATGTGAATGGTCTATTTTCAAGAGTCGTTTAACACAGTTTTTAAAAGTAAATGACGTATCGGAAGAAAAGAAAAGTGCTATCCTCATTACGCACCTCTCCGATGAGGCGTACCGTCTAGTGCGAAATTTAGCATACCCCAAAGATGCTGATTCATTTTCGTATGTGGAGCTGGTTTCATTACTCGATAATCATTTTAAGCCAAAGAAGTGTTCATATACCGACAAGGCTCGTTTTTATGGGGCTACGAGAACCCCAGGCGAATCATTAGGAGACTGGGCGGCGCGACTTAGGGGGTTGGCAAGTTATTGCGAATTCGGCGCGGCTTTGGAAACGAACCTTACGGATCGTTTTGTCCTAGGCCTGGGCTCAGGTCCAGCACGAGATAAGCTGTACGAGCAGGACCCATCAAAAATGAAAATCGATCGAGCGTTAGAAATAGCCCAGCAGGCAGAGAGTGCGAGGGAGGCTAAGTTCATGGAAGTTAGTGTTAAGGAAGAACCTGTGTACCGTGCCTCCTTCACGCTCGACGATAGACGTGAAGCTAATCGACGAGCGCGGACGAGTGAGCCAAGCAGTGGTTATTCAGGGCAGCGGCAGCGGTCCCACCTTGGTGATGGTCAATCAGTTCGCGGGCAGCAACCACGTCGTGACTTCCCAAGGTGCTCGGTTTGCGGGTTAAGAAACCACGACGAAGAGAAGTGCCGTTACAAGGGCTATCGCTGTCAGAAGTGCGGTGAAAAGGGACATTTAAAAAAAGTGTGTGACAAAAATGTGCAGATCAATAATATTTGTGATGACCACGATAAAGGTGTCGGCCACATTCCGGATCCTGACCATTGTGAGGAATGTCATAATTATAGTTTAAAGTACGTGTCTGATAAGCCGATTAATTTAAAATTATTGCTAGGTGGCAAGAGCATAACAATGGAGTTAGATTCTGGTTCTGGGACATCAGTGATATCAAAATCATTATACGATACATTGTTTTCGAAGTACAAGTTAAATAAATGTAACATCAAAATGTGCCTTTATAACGGACATAAAATTTCACCGGAAGGGTATTTTGATATCGAGGCAAAATTTAATCAACAACAAAAAAACTTAAAATTATTTGTTATTAAAAACGGTGGCCCTCCACTTCTCGGTCGAGATTTTATGTCCGCCTTCGGTGTAACGTTTACCACTGGTCTTCATAACATTTGTTATACCGATAAAGATGTTCAAAGTTTGCTAGAACAATTTCCAGATCTGTGGCGTGACGAATTAGGGTCATTCACAAAATTTCAGGTCGATTTAAAATTAAAAGAGGATGCTGTACCAAAGTTTTTCAAACCTCGAACGGTACCATTCGCGCTCAAAGCTAAGGTAGAAGCCGAGTTGGATAGAAATTTTATTCCCAACGCATCATGTATTATGAGTCCACTTCACGAGTTACTCCGCAACGGCGCGCAGTGGGAATGGACGGAGCGGCAACGTCGCGCGGTGCATCAGGTAAAGACCGAGTTGGCATCGGAGCGCGTCCTTGCCCACTTCGAGCACGACGCTCAGCTGATTCTGACCGTAGATGCGGGCCCAGGCGGCCTCGGCGCGGTGCTGGCCCAGAGGCATATCGATCAGATTCTTAGAAGTAAGGAAGATTTTGAAAAAAAGAGTTGTATTACTAGTACGTCGCCTCCATTTTCCAACACAACAATTTTAGCAAAACCTAACAAAACCAATTATAGCGATGGTTCGATTATGACTTCTGTAGCTCAACAGGCTGTGGGAATGGAAAGTGGAGACGGACGTAACGAGCAAGAAAATGTAGTAACCGATATTGGTGACATTGTCCAGCCAACTGACGAGATCTGGGGTGATTGCGAAGAAGTTGACCTTGAACGGGAGAACCTAGTTCCTGGCAGTTCAGCCGAGCCTCCGGCGCCGCCGCTGGCGTTGTCGTCACCAGTCGCGTCTAAACGTACCTCACCTGTTTCTGATCCACATCAGCCCGGACCCTCGTCCTTAACTTATTCCCCACCGCTCACACGTCGCAAGAAGAGAGTTGATTACAAGCAATTCTATTATTGA
Protein
MSYLGNLPIYDHKTCEWSIFKSRLTQFLKVNDVSEEKKSAILITHLSDEAYRLVRNLAYPKDADSFSYVELVSLLDNHFKPKKCSYTDKARFYGATRTPGESLGDWAARLRGLASYCEFGAALETNLTDRFVLGLGSGPARDKLYEQDPSKMKIDRALEIAQQAESAREAKFMEVSVKEEPVYRASFTLDDRREANRRARTSEPSSGYSGQRQRSHLGDGQSVRGQQPRRDFPRCSVCGLRNHDEEKCRYKGYRCQKCGEKGHLKKVCDKNVQINNICDDHDKGVGHIPDPDHCEECHNYSLKYVSDKPINLKLLLGGKSITMELDSGSGTSVISKSLYDTLFSKYKLNKCNIKMCLYNGHKISPEGYFDIEAKFNQQQKNLKLFVIKNGGPPLLGRDFMSAFGVTFTTGLHNICYTDKDVQSLLEQFPDLWRDELGSFTKFQVDLKLKEDAVPKFFKPRTVPFALKAKVEAELDRNFIPNASCIMSPLHELLRNGAQWEWTERQRRAVHQVKTELASERVLAHFEHDAQLILTVDAGPGGLGAVLAQRHIDQILRSKEDFEKKSCITSTSPPFSNTTILAKPNKTNYSDGSIMTSVAQQAVGMESGDGRNEQENVVTDIGDIVQPTDEIWGDCEEVDLERENLVPGSSAEPPAPPLALSSPVASKRTSPVSDPHQPGPSSLTYSPPLTRRKKRVDYKQFYY

Summary

Pfam
PF00078   RVT_1        + More
PF00665   rve
PF17921   Integrase_H2C2
PF17919   RT_RNaseH_2
PF17917   RT_RNaseH
PF05485   THAP
PF00098   zf-CCHC
PF00378   ECH_1
Interpro
IPR012337   RNaseH-like_sf        + More
IPR001584   Integrase_cat-core       
IPR041577   RT_RNaseH_2       
IPR000477   RT_dom       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR021109   Peptidase_aspartic_dom_sf       
IPR041373   RT_RNaseH       
IPR036875   Znf_CCHC_sf       
IPR006612   THAP_Znf       
IPR001878   Znf_CCHC       
IPR001995   Peptidase_A2_cat       
IPR001753   Enoyl-CoA_hydra/iso       
IPR029045   ClpP/crotonase-like_dom_sf       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF57756   SSF57756       
SSF52096   SSF52096       
Gene 3D
PDB
4OL8     E-value=9.21836e-08,     Score=137

Ontologies

Topology

Length:
702
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01239
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00008
outside
1  -  702
 
 

Population Genetic Test Statistics

Pi
243.139591
Theta
162.682723
Tajima's D
1.395871
CLR
10.814854
CSRT
0.764361781910904
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号