SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06151
Annotation
retrovirus-related_gag-pol_polyprotein_[Lasius_niger]
Location in the cell
Nuclear   Reliability : 1.898
 

Sequence

CDS
ATGTTTAAAATTAACTACGTATTGTTAATTTTTGTTTTATCGAACTGTGTTAATTGTAATGTTTACATTGGGAATGGCAAAATGAAACAATTGTACGCTTGGAAGCAATTAGGATACGATTTTAATGGAACAAAATATATAAAAGATGCAGACCGCATACGCTCGCCCGGAGCGATACATTTCGTCCAAGAGCTAGGAGACAGCGAGAAATTCTTTATACAGTACAATAATGTGCCGACAGGAATCAAGTTTGTCGGAGATCTGCTATTTTTGACGGTCCCAAGGAGGAGATTTGGGATTCCATCGACGTTAAACTACATAGACAGGAGACACAGTAAAAAACTGGATCCACTTCTGAAGCCTTATCCAAATCCAGAGGCGGTCTCGTCTCTGACATCGGTATACCGGACTGCGATCGACTCGTGTGCCAGACTGTGGATGGTGGATACCGGACTGCTAGAGGTTCCCGGTGCGAGAAGACAAGTGAAGCCACCGGCGATCCTGGCTTACAATTGGCTGACACATAAGCTGGATTTCAGATACGAACTGGATCCGAAGGTATTGGTCAATGAGCGAACTCCTGGTGGTCTGACGTCGCTTACGATCGACGTGGAGCCGACTGCTTGTGGCGAGGCGCACGCCTACATAACGGACTTGGCGACTAATGGCCTGATTGTCTTCTCTCTGGGAGCCCGAGCTTTCTGGAGGATCGACCACCCGAGCTTCGTTCATGGCGAGAAAGCTTTGAACTTCACCGTAGCGGGCAACGTCATTAGCTGGAAAGATGGTTTGTTCAGCATCGCTTTATCCGATGTTGGTGGCAAGAGATTGGCATACTACCATCCCATGGTGTCGACTCACGAGTACGCCATAGACACGGCCGTCCTGAAGAATGGGGGAGCTGACTTCGACAAGGAGTATAAAGTGTTGGGGAGCCGTGGTCCGCTGTCCCAGAGCGGGATACACTCCCACCACGCAGCGAGTAGTGTATTGTTCTACGCGAATGTCGCCCGGGATGGGATCGTCTGTTGGAACACGAAGAAACCGCTCGTCGAGGAGAATGTCGCTCTGATCGTTCAGGATCGAGAGAAGCTGCTTTACATCACCGATTTAGCGATAAGGCAGAATGAGCTTTACGTGTTGGTCAATAAAATGCCAGTTTTTGTATTTTCAATGTTGAACAAAGAAGAATATAATTTCTTCATGCACAGAAACTACAAAATGACTTCTAATATTAAGATTGATCGACTTACGGGTGATAACTATGACACCTGGAAGATTCACATGCGAGCTATTCTGAAGAAGAATGATTTGTGGGAATACGTATCAGGAAAAATACCGAAACCAATACATTCAGATTCTAAATATTCTGAATGGAATAAAATGGACGGAAAAGCCGAATCGGACATATTGTTAGCTGTCAGCCCGAGCGAGTTAATTGCACTGGATGGTTTAGACTCCTCTAAAGCAATATGGGACAAGTTAAAATCTATGTATGAGTCAAGCGGGCCAGCGCGAAAAGCGTCATTACTAAAGAGACTTGTATTAAAGCGTATGCCAGAAGATGGAGACATACGAAAACATATTTCTGATTTTTTCGACTGTGTTAAGAAGCTTAAAGAAATCGGATTAATAGTGATAGATGAGTTGCTTGCTATTTTATTACTTTATAGTTTACCGGATTCGTTCTCAATGTTTCGAACAGCAATGGAATCGCGTGATGATTTACCATCAACTGATATACTGAAAGTGAAGATTATCGAGGATTATGAAGGTCGGAAGAATTTGAATTTGGCTAATGGTAAAACTACAAAAATTAGCGGTTCGGGAAAAGTCAGTATTATGGTAGACACAGGCAGCGAAAAGCGCCATGTTGATATTAAAAAAGTGTTCTACGTGTCGGATCTACGAACTAATTTATTATCAGTTGCGAAGATGACAGATCACGGGTTTGAAGTTCGCTTCAATAAAAATTATGCAATTGTCATAGATGACAATAATAAGGTTCATATGCGAGCGGATCGAGTTGGTAACTTATACCACGTCCGAATGAGCCAAGATGATGTCAATAATGTTGAAATGGTGAAAAAACCTATAGATATGTGGCACGAGCGCCTCGGCCACCTTAACGAGCGTGATTTGAAGGCAATGGCGAAAAATGGCCTTGTTCATGGCCTATCATTGAAGGACAACGAAAAATTGTCAGAGTGTGAAATATGTATAAGTGAAAAACAGACATGCACGCCTTTTTCTAAAGGAAGCGAAGATCGTACCAGTGAACTATTGGAGATCGTGCATACAGATGTGTGCGGACCAATGAGACAACAGTCTATGGGCGGTAAAAAGTATTTTGTCACGTTCATCGACGACAAATCAAGATGGTGTGAAGTATACTTTATTGCTAATAAAAGCGACGTACTTCAAGTTTTCAAAGATTACAAGGCTTACGTGGAAAAATTGACAGGAAAGAAGATCAAAAATCTACAATCCGATAACGGTCGAGAATATATTAACAAAGACTTTGATGATTTCTTGAAGAAAGAAGGAATAAGACGGAGGTTGACGGCACCTTATACGCCTCAGCAGAACGGGATTTCGGAGAGAAAGAACAGGACACTGCTGGAGATGGCCCGTTGTATGATGCGTCAGGCGGGAAGCCCTCCTGTTTTTTGGGCTGAAGCAATTAATACTGCTAATTACATAAGGAACCGGTGCCCAACTGCAGCTCTTGATGGTCAAATACCATTTACCCTGTGGAAAAGAAAGAAACCTACCGTAATCTACATGCGTTTGTTTGGATCGAAAGCGTATTATAAAAACAAAGGAACGCAGAAGGGAAAATTCGAATTAAGTTCAGAGCTTGGAATATTTATGGGCTATGATACTGAGTCTAAAGCTTACAGAATACATGATCCTAAGACTAGAAGGATCGTCATTTCTCGCGATGTGAAGTTTATGAACGAGACAGCATTCTGTCATGAGTATAAAGAAATACGAAATGATGAAGAAGAGAGTTTTGATAATTCGAAGATAGTCGTTGAATTGATAGGACATGATCAGAAGAAGGAAAATCGAAAAACAAACCCCATGAGAGGGAGAGGAAGACCAAGGATAGTTCGTACTGGCTTAGTGGGAAGACCGCGCAAAGAGTATAAACCAGCTACTATCAGTACAGAGAGTGAAACTGAATCAGAGTATGAAGTAGATAATGAAGAAACAACAGCTGGAATTGCGATTATTGAACCTAAAACATGGAAAGAAATAGAAAAGACTGATGACGAACCTGAATGGCGAAGGGCTTTAGAAGACGAGTATTTGGCACAATTAAAGAATGTTACATGGGAAATAGTCCCACGACCGAAAAATAGAAAAGTGATTGGTAGCAGATTTGTATTTCAAACAAAGAATACAGGGAAGAAAGTACGGCTTGTCGCAAAGGGATGTTCTCAAAGGCCAGGGGAGGATATTTACGAAACCTCTTCTCCTGTTGTAAGGTCTTCATCTGTGAGACTCATAGCTGCAGTGTCAGCTGAGTTAGGATTAGAGATGCATCAAATGGATGTAGTAACAGCTTACTTGAATGGTACTCTCGAAGAAGATGTATTCATGGAAATACCAGATAAACTATCAGATGTCTTAGAAAGTGTACTAGCAAACCAAAATATTGGATCAAAAAGAAATATTATAAGAGATAAGAATATACTTCATACAGCTAAACGCTGGAACGAAGCATTGAATGAGTGTGAGAATAATGTGTGTTTGTTAAAGAAGTCTTTGTATGGTTTGCGTCAATCAGGATTACAGTGGCATAAAAAGTTAGTAGGAAGGTTGAAGAATATTGGTTTTGAAGCATTACCACAAGAACCTTGTGTGTTTGTTGCGCAAAGGGATGAAAAAATGATGTTAATTGCTATTTATGTAGATGACATTATCCTAGCTACTAATGATGAGGTGTGGTTGCATGATGTTAAGCGTAAGTTATCTAATGCCTTTGAAATGAAGGATATGGGAAAAATCAGTACTTGTTTGGGTATCGAATTTTCACGTGATAAGGAGCATAGAGTGTATTTAAAGCAAGGTGCGTATATAGATAAAGTATTAGAGCGTTATGGTATGAGTGATTGTAAACCTATATCAACACCTATGGATGTGAACGTTAAACTAGAAAAACCCAACAGTGTAAACAATGATGTTATGAGTCAGTACCCTTACCAGAACCTTATAGGTGCCCTTATGTATTTGGCTGTATCTACCAGACCGGATATAGCTTATACTGTAAATTATTTAAGCCAATTTAACACTAATTATGATGTACAGCATTGGAAGGCAGCTAAGCGAGTGTTGAGGTATTTGAAAGGTACATCAACTTTCGGCTTAATGTATGAGAGGACAGGTGTACCATTGTTTGGTGTAGTTGATGCAGACTGGGGTGCAAATACGATTGATCGAAGGTCATATTCCGGTTTTGCATTTATTTTAGCAGGTGCCCCAATTACCTGGGAAGCACGAAAACAGCGTACCGTTGCATTATCGAGCACAGAAGCAGAGTACTTGGCGCTTTCTGAAGCAACTAAGGAAGCTATGTATCTCAGAAATGTGGTAAATAATGTTGGTGTAAAATGTGGTTGTGTGACATTATTTAATGACAACCAGGGTGCTATGAAGCTTGCACAGAGTAGAAGCTATCATTCTCGCACTAAGCATATTGATGTTAGACACCATTTTGTTCGAGATATGTGTGAACAGGGTGTGATTGATTTGAAATACTTGAGTACAGACAAAATGCCTGCTGATATTTTGACCAAGGGCTTGTGTGGGATGAAGCATTATGAATGCATGAACAATTTAGGAATGATGGAATAA
Protein
MFKINYVLLIFVLSNCVNCNVYIGNGKMKQLYAWKQLGYDFNGTKYIKDADRIRSPGAIHFVQELGDSEKFFIQYNNVPTGIKFVGDLLFLTVPRRRFGIPSTLNYIDRRHSKKLDPLLKPYPNPEAVSSLTSVYRTAIDSCARLWMVDTGLLEVPGARRQVKPPAILAYNWLTHKLDFRYELDPKVLVNERTPGGLTSLTIDVEPTACGEAHAYITDLATNGLIVFSLGARAFWRIDHPSFVHGEKALNFTVAGNVISWKDGLFSIALSDVGGKRLAYYHPMVSTHEYAIDTAVLKNGGADFDKEYKVLGSRGPLSQSGIHSHHAASSVLFYANVARDGIVCWNTKKPLVEENVALIVQDREKLLYITDLAIRQNELYVLVNKMPVFVFSMLNKEEYNFFMHRNYKMTSNIKIDRLTGDNYDTWKIHMRAILKKNDLWEYVSGKIPKPIHSDSKYSEWNKMDGKAESDILLAVSPSELIALDGLDSSKAIWDKLKSMYESSGPARKASLLKRLVLKRMPEDGDIRKHISDFFDCVKKLKEIGLIVIDELLAILLLYSLPDSFSMFRTAMESRDDLPSTDILKVKIIEDYEGRKNLNLANGKTTKISGSGKVSIMVDTGSEKRHVDIKKVFYVSDLRTNLLSVAKMTDHGFEVRFNKNYAIVIDDNNKVHMRADRVGNLYHVRMSQDDVNNVEMVKKPIDMWHERLGHLNERDLKAMAKNGLVHGLSLKDNEKLSECEICISEKQTCTPFSKGSEDRTSELLEIVHTDVCGPMRQQSMGGKKYFVTFIDDKSRWCEVYFIANKSDVLQVFKDYKAYVEKLTGKKIKNLQSDNGREYINKDFDDFLKKEGIRRRLTAPYTPQQNGISERKNRTLLEMARCMMRQAGSPPVFWAEAINTANYIRNRCPTAALDGQIPFTLWKRKKPTVIYMRLFGSKAYYKNKGTQKGKFELSSELGIFMGYDTESKAYRIHDPKTRRIVISRDVKFMNETAFCHEYKEIRNDEEESFDNSKIVVELIGHDQKKENRKTNPMRGRGRPRIVRTGLVGRPRKEYKPATISTESETESEYEVDNEETTAGIAIIEPKTWKEIEKTDDEPEWRRALEDEYLAQLKNVTWEIVPRPKNRKVIGSRFVFQTKNTGKKVRLVAKGCSQRPGEDIYETSSPVVRSSSVRLIAAVSAELGLEMHQMDVVTAYLNGTLEEDVFMEIPDKLSDVLESVLANQNIGSKRNIIRDKNILHTAKRWNEALNECENNVCLLKKSLYGLRQSGLQWHKKLVGRLKNIGFEALPQEPCVFVAQRDEKMMLIAIYVDDIILATNDEVWLHDVKRKLSNAFEMKDMGKISTCLGIEFSRDKEHRVYLKQGAYIDKVLERYGMSDCKPISTPMDVNVKLEKPNSVNNDVMSQYPYQNLIGALMYLAVSTRPDIAYTVNYLSQFNTNYDVQHWKAAKRVLRYLKGTSTFGLMYERTGVPLFGVVDADWGANTIDRRSYSGFAFILAGAPITWEARKQRTVALSSTEAEYLALSEATKEAMYLRNVVNNVGVKCGCVTLFNDNQGAMKLAQSRSYHSRTKHIDVRHHFVRDMCEQGVIDLKYLSTDKMPADILTKGLCGMKHYECMNNLGMME

Summary

Pfam
PF13976   gag_pre-integrs        + More
PF00665   rve
PF07727   RVT_2
PF00098   zf-CCHC
Interpro
IPR012337   RNaseH-like_sf        + More
IPR013103   RVT_2       
IPR001584   Integrase_cat-core       
IPR039537   Retrotran_Ty1/copia-like       
IPR025724   GAG-pre-integrase_dom       
IPR036397   RNaseH_sf       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
Gene 3D
PDB
3Q6T     E-value=2.16321e-28,     Score=319

Ontologies

Topology

SignalP
Position:   1 - 19,         Likelihood:  0.992045
 
 
Length:
1620
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
11.3633399999999
Exp number, first 60 AAs:
10.96563
Total prob of N-in:
0.54275
POSSIBLE N-term signal
sequence
outside
1  -  1620
 
 

Population Genetic Test Statistics

Pi
25.51381
Theta
182.791099
Tajima's D
1.301269
CLR
1.8635
CSRT
0.736563171841408
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号