SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06106  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA001695
Annotation
PREDICTED:_lysosomal_alpha-mannosidase-like?_partial_[Bombyx_mori]
Full name
Alpha-mannosidase      
Location in the cell
Cytoplasmic   Reliability : 2.544
 

Sequence

CDS
ATGCTGGTACTCGCGCTGCTGTGCCTCCTGAGCATATCATCAAGCGTTCCCCTGCATGACCAGATAACTCCGAGGCCCGGGGAGACGTGTGGCTATGAGAGCTGTCCGAAGACCGAGCCGGGTGTGCTGAACGTCCACATCGTACCCCACACCCACGACGACGTCGGCTGGCTGAAGACCGTCGACCAGTACTATTACGGAAGCAGGAACAACATACAGAAGGCTGGCGTTCAATACATTCTGGATTCGGTTGTCAAGGAGCTGTGGGAAGACCCGAAGCGACGGTTTATCTACGTGGAGACGGCTTTCTTCTGGAAGTGGTGGGTCAGGCAGTCCCGTCGGGTCAAGAGTAAGGTCCACACCCTCGTCAGGCAGGGGCGGCTTCAATTCGTCGGTGGGGCGTGGTCCATGAACGATGAGGCCGCAGTGCACTATCAAAGTACCATCGATCAATTCACTTGGGGTCTCAGCAAATTGAACGAGACCTTCGGTTACTGCGGCTTGCCCCGGGTTGGCTGGCAGATCGACCCGTTCGGGCACTCGAGGGAGCTGGCTTCGCTGCTGTCCGCCATGGGATATGACGGCTTGTTCCTGGGCAGGATCGATTATCAAGACAAGAGGACCAGACTCCGAGACAAGACCATGGAGATGGTATGGAGGGGCGACGACGACTTGGGCAAGAAGTCAGACATCTTCACGGGCGCTTTGTACAACACATACTCTCCGCCGGCCGGGTTCTGCTTCGACGTCCTGTGTGACGACGAGCCCATAGTGGACGACGCTGGCTCGCCGCTGTACAATGTCGACAACAAGATGACCCTATTTCTGAACTACGTTAAAAAGCAATCGCAACATTATCGAACGGACAATGTCATCATCACGATGGGAGGAGATTTCACTTACCAAGACGCCGCGATGTGGTACACGAATCTGGACAAGCTGATTGAATATTCAAATCTGAAGGCGGCCAAAGACGATCTGAAGATTAAGCTGTTTTATTCGACGCCTAATTGTTATCTGAAAGCCATAAAAGACGCGAATCCGGTGTTGCCAACGAAACAAGACGACTTCTTCCCGTACGCGAGCGACCCGACCGCTTACTGGACCGGGTACTTCACCTCGAGACCGACCACCAAGTACTTCGAGAGAGAGGGGAACGCTTACCTGCAGATGGTGAAACAGCTGCAGGTGTTGTCGAATTTGGAAAGGCACAACGAGTTCATTCTGAACGAACTGAAGAGCGCAATGGGCATAATGCAACACCACGACGCCATCACCGGCACCGAGAAGCAGCACGTCGCTCATGACTACGAAAGGATCCTGAGCACCGCCATCGACGACGCTCTACTCGTCGCCAGACAGGCCTTCAACAAAGCCGCCCAGGGCGACTCCGGGAAGGCTCCGCTGTTCAGCTACGACAGGTGTCACTTCAACGAATCCAGATGCCACACGTCGGAGACCAGCGAAACGTTCATGCGATTAAGAGGATCAGAGTCAGGGTCAGTTGTTGGCCGGATCAGCACCAAGAGGCTCGATGCGGCCTATAAGCCGGCTGTCTTGCAGGTGACCGTTTACAACCCGTTGGCTTGGGGCGTCAGGGAGGCGGTGAAGCTGCCGGTCACGTATGGACACTACGAGGTCTACGCTCCGAATGGCGATAAAATCGTGACGCAACTGGTCGAGATACCGGACGAGGTTAAGCGCATACCGAACCGACGGTCTGAGGCCACTCACGAGTTGGTGTTCATTGCGCACTTACATCCGTTGGGCGTGAAATCGTTCTACGTTAAAAGAGTTTCGACAACGAAAAGGGCAATCGCTAACGGCAGCTATTTGGAATGGATCAGTGGCGAGGGGGTCCGGTCCGATGGCTATTTAGATAGGCTCAATCAGATAGCCGACGTCAAAGACCTCACGAATCTCGGCCTAGATGCTATTGTTGATGAAGGCAAGGAACCTTTGTGGGAAGATGCAAATGGAACTGGTGCGGCTTTCAAAGGGACTATGAAGAAAAGAGAGACGGACGACTTTAAGATATCGTTCGCGTATTACCCGGGCTGCTTGGGGAACAATGAGGTACCCGCTAACCGCAGTTCAGGCGCGTACATCTTCAGGCCGAACTCGACAAAAGCAATCGGTCTGAACGTGGAATCTGTGAGTGAAATTAGCGGCGACCTACTCAGCGAGGTTCGAACTAAGATACGCGGAAACGTTTTGAGCATCAAGCGTGTTTACAAGGAATTCGATTTTATTGAGCACGAGTGGCTCGTGGGCCCGATAAGCGTCGACGACGGCATCGGCAAGGAGTACGTGGTCAAGTACCAGACGGATATAATAAATAATGGAGAGTTTTACACGGATTCAAACGGCCGACAGATGCTGAAGAGGAAACTGAACGCGCGTCCTCAGTGGAACTTGACGTTGACCGAGCCGGTGCCCGGGAATTATTATCCGGTCACGAACGAGATCTACATCGAGAACGGCGAGAGGTTCACGGTCTTGACGGACCGATCGCAAGGCGGAACCTCGCTCGTCGAAGGCGAAGTGGAACTGATGCTGCACAGGAGATTGCTGCACGACGACGCGTTCGGCGTCGGTGAGGCCCTGAACGAAACGGTTCTCGGCTCGGGGCTGGTGGTTCGCGGGAAACACCGGATCCTGCGCTCGAAGGATCCGGTTGAGATCGCGAAAAGCGTTTTCCAAATGCACCTGCCGCCCGTGGTCTTCGTTTCCGACGCCTCAGGCCTCAGCTACGAGCAATGGATGAGGTTGGAGAATTGCAAGAAGTTTGTCAAGACCCCGATGCCTGACGGGCTCCATCTGCTCACCCTGGAGCCTTGGGGCGACCAGATCCTGTTGAGAATCGAAAACTACAAGACCGGTGCCGAAGATTCGACCATCGAAATTGACCTGCAGGGCATATTCAACGGTATCCATATCAAAAGCGTAAAAGAGACAACGCTAGCCGCAAACCAGTGGCTGGACGACTATGATAAGTGGACTTGGAATACGGAAGGAGACTTTTACGAAAGCTTCAACAAGAAATACGGGAGCTTCGAGGCCGTGAACAAAGCTGTCGACGGACCTGACGTCAGAGAGGACGAAGGCCTCAAAATCAAACTTAAAGCGAAGGAGATAAGGTCGTTTATAGCGGATATCGAATATACCGACTAA
Protein
MLVLALLCLLSISSSVPLHDQITPRPGETCGYESCPKTEPGVLNVHIVPHTHDDVGWLKTVDQYYYGSRNNIQKAGVQYILDSVVKELWEDPKRRFIYVETAFFWKWWVRQSRRVKSKVHTLVRQGRLQFVGGAWSMNDEAAVHYQSTIDQFTWGLSKLNETFGYCGLPRVGWQIDPFGHSRELASLLSAMGYDGLFLGRIDYQDKRTRLRDKTMEMVWRGDDDLGKKSDIFTGALYNTYSPPAGFCFDVLCDDEPIVDDAGSPLYNVDNKMTLFLNYVKKQSQHYRTDNVIITMGGDFTYQDAAMWYTNLDKLIEYSNLKAAKDDLKIKLFYSTPNCYLKAIKDANPVLPTKQDDFFPYASDPTAYWTGYFTSRPTTKYFEREGNAYLQMVKQLQVLSNLERHNEFILNELKSAMGIMQHHDAITGTEKQHVAHDYERILSTAIDDALLVARQAFNKAAQGDSGKAPLFSYDRCHFNESRCHTSETSETFMRLRGSESGSVVGRISTKRLDAAYKPAVLQVTVYNPLAWGVREAVKLPVTYGHYEVYAPNGDKIVTQLVEIPDEVKRIPNRRSEATHELVFIAHLHPLGVKSFYVKRVSTTKRAIANGSYLEWISGEGVRSDGYLDRLNQIADVKDLTNLGLDAIVDEGKEPLWEDANGTGAAFKGTMKKRETDDFKISFAYYPGCLGNNEVPANRSSGAYIFRPNSTKAIGLNVESVSEISGDLLSEVRTKIRGNVLSIKRVYKEFDFIEHEWLVGPISVDDGIGKEYVVKYQTDIINNGEFYTDSNGRQMLKRKLNARPQWNLTLTEPVPGNYYPVTNEIYIENGERFTVLTDRSQGGTSLVEGEVELMLHRRLLHDDAFGVGEALNETVLGSGLVVRGKHRILRSKDPVEIAKSVFQMHLPPVVFVSDASGLSYEQWMRLENCKKFVKTPMPDGLHLLTLEPWGDQILLRIENYKTGAEDSTIEIDLQGIFNGIHIKSVKETTLAANQWLDDYDKWTWNTEGDFYESFNKKYGSFEAVNKAVDGPDVREDEGLKIKLKAKEIRSFIADIEYTD

Summary

Cofactor
Zn(2+)
Similarity
Belongs to the glycosyl hydrolase 38 family.
Feature
chain  Alpha-mannosidase
EC Number
3.2.1.-
EMBL
NEVH01002545    PNF42229.1    PNF42230.1    UFQS01000218    UFQT01000218    SSX01504.1    + More
SSX21884.1    SSX01503.1    SSX21883.1    GFDL01006179    JAV28866.1    GANO01001972    JAB57899.1    GAPW01000077    JAC13521.1    KK853110    KDR11229.1    CVRI01000038    CRK93801.1    UFQT01000391    SSX23894.1    ATLV01012390    KE524787    KFB36711.1    CH916372    EDV98984.1    GBYB01009698    JAG79465.1    GFDL01006180    JAV28865.1    CRK93802.1    CH902620    EDV32357.1    PYGN01000238    PSN50451.1    AAAB01008944    CH477358    EAT42740.1    AXCN02000716    KPU73915.1    EAL40242.3    ATLV01012389    KFB36708.1    EAT42739.1    ADMH02000752    ETN65165.1    KQ971332    EEZ99703.1    MK075175    AYV99578.1    APCN01000712    APCN01000713    APCN01000714    APCN01000715    KQ981891    KYN33784.1    GDHF01027225    GDHF01012263    JAI25089.1    JAI40051.1    KK107648    QOIP01000008    EZA48346.1    RLU19783.1    GAPW01000098    JAC13500.1    GDHF01030990    JAI21324.1    CH940649    KRF81022.1    GDHF01010454    JAI41860.1    CH933807    KRG03704.1    CP012523    ALC39282.1    CH479180    EDW28309.1    JXJN01006781    GFDL01007289    JAV27756.1    CM000361    CM002910    EDX04554.1    KMY89555.1    GEZM01085309    JAV60008.1    GBXI01009935    JAD04357.1    AF145601    AE014134    AAD38576.1    AAF52958.2    KMY89556.1    GDHF01010271    GDHF01002021    JAI42043.1    JAI50293.1    GL762576    EFZ21090.1    CH954177    KQS70602.1    EDW63296.2    KQ978112    KYM96921.1    EDV59030.2    AAN10754.1    CM000157    KRJ97497.1    GBXI01004996    JAD09296.1    GGFL01014681    MBW78859.1    KQ980167    KYN17373.1    GAKP01021245    JAC37707.1    GAMC01015917    GAMC01015916    GAMC01015915    GAMC01015914    JAB90640.1    ABLF02026049    GDHF01003182    JAI49132.1    ADTU01022012    ADTU01022013    ADTU01022014    GL445930    EFN88812.1    GFXV01004418    MBW16223.1    GFDF01005288    JAV08796.1    GFDF01005289    JAV08795.1    GFAH01000335    JAV48054.1    GGMS01017236    MBY86439.1    GDIQ01056497    JAN38240.1    GDIQ01018628    JAN76109.1    LRGB01001005    KZS14076.1    GDIQ01144965    JAL06761.1    GDIP01203317    JAJ20085.1    GDIP01060333    JAM43382.1    GDIP01201762    JAJ21640.1   
Pfam
PF09261   Alpha-mann_mid        + More
PF07748   Glyco_hydro_38C
PF17677   Glyco_hydro38C2
PF01074   Glyco_hydro_38N
Interpro
IPR015341   Glyco_hydro_38_cen        + More
IPR011013   Gal_mutarotase_sf_dom       
IPR011330   Glyco_hydro/deAcase_b/a-brl       
IPR000602   Glyco_hydro_38_N       
IPR041147   GH38_C       
IPR037094   Glyco_hydro_38_cen_sf       
IPR027291   Glyco_hydro_38_N_sf       
IPR028995   Glyco_hydro_57/38_cen_sf       
IPR013780   Glyco_hydro_b       
IPR011682   Glyco_hydro_38_C       
SUPFAM
SSF88713   SSF88713        + More
SSF88688   SSF88688       
SSF74650   SSF74650       
PDB
6B9P     E-value=3.76021e-155,     Score=1410

Ontologies

Topology

SignalP
Position:   1 - 15,         Likelihood:  0.997810
 
 
Length:
1057
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0253399999999999
Exp number, first 60 AAs:
0.01927
Total prob of N-in:
0.00104
outside
1  -  1057
 
 

Population Genetic Test Statistics

Pi
210.623017
Theta
172.223727
Tajima's D
1.412322
CLR
0.448859
CSRT
0.773311334433278
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
25044914 EFDFHIIPSGIINQK 95.45 2e-09
24402669 EFDFHIIPSGIINQK 95.45 2e-09
26822097 QTIYSIDANIR 100.00 8e-06
29197581 TVDQYYYGSR 100.00 0.001
26822097 MGTYVIEIFPNAK 100.00 0.006
25044914 VGWIFTDIVPIDVSK 100.00 0.006
24402669 VGTNDIVITIR 100.00 0.006
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号