SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06105  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA001730
Annotation
PREDICTED:_gelsolin?_cytoplasmic-like_[Papilio_xuthus]
Location in the cell
Cytoplasmic   Reliability : 1.735 ER   Reliability : 1.341 Nuclear   Reliability : 1.084
 

Sequence

CDS
ATGGAGAATCCGGTGTTTGAGGAGGCAGGAAACCAGGCCGGCATAGAGATCTGGACTATTGAGAACTTCGAGCCGGTTCCCTTTGATCCCAAGTACTATGGGAAATTCTACAACGGCGACTCCTACATCGTGTTGAAGACCACGGAGGAGTCATCCTCGCTGACCCACGACGCCCACTTCTGGCTGGGCAGCAAGACCACTCAGGACAAAAAGGGCTCCGCTGCCATATGGACGATCACGTTAGACGACATGCTGGGCGGCAGAGCTGTGCATCACCGCGAGGTCCAGGGACACGAGTCCAGTTTGTTTCTGAGCTATTTCAAGCCAGCCATCAGATACCTCGAAGGCGGGAACGAGTCTGGCTTCAACGAAGTGCAGACCAACGCTGGTGCTGAGAAACGTCTCCTGAAGCTGTCCGGATGCGACAACATGAGGATCGAGGAGGTCGCAGCCGAGGCCTCGTCTCTGACAAAGAACCACTGCTTCATCTTGGAGAACGAGCACGACATCTTCGTGCTGATGCCGGAGGGCGCGAAAGCCACCCAGAGGCGGAAGATCATCAGCGTCGCCAACAAACTGAGGGACGAGGAACACAACGGGAGAGCCACTATTGAAATCATCGATGAATTCTCGTCAGATGAAGACGTGAATTTGTTCTTCGAAACCCTAGGATCCGGCTCAATGGATGAATTAGTTAGCGACGACACTTCAGAGAGCTACACCAGATCAGATATTTCGGCGGTGTACCTCTACAAAGTGTTGGACGGTGATGAGCAAGAATTAGTCTCCATGAACAAGCCCTACAAGCAGAAACATTTGGCCAGTGACGCAATGTACATTCTGGACACGGGAGACACTGGCGTTTACATCTGGCTGGGGTCGGACCTGGACGCTGACGTTAAGAGGAAATACCACGAGATCGCTGGAAAGTATTTAGAAGACAAGGGATACCCGAGCTGGGTCCACGTGACGAGAGTGTCGGAGGGCGCGGAGAGCTCGACCTTCAAGCAGTACTTCCACAACTGGGACACGGTGCGGACCGGGGGCTCGGTCAGGGGAATCATATCTGAAATCGATTCGGGGTACTTCTCTGGGGACGCTGAGGAGTCGGCGGCCGCGGCCAGGACGATCGGCAAGAGCGCCACAGCACGGGGCTACATGCCGGACCAGGGCGAAGGGAGTCTCACGGTGACCAGGATCTCTGGTGATCAAGAAGACGTGACAGACAGATTCCAGCAGGGGACCTCCGTGCTGTACCAATCAGAGGTCTACGTCATCACTTACAAATACCAGAATGAGAACGAGGAAGATGCCTGGGTGGTTTACTTGTGGATCGGTTCAGAAGCGAGTGATGACGACAAAGAGGCCGGGCAGATGCTACTGTCGCAGCTAGAAGAGGATCTAGAAGGAAATGTTACATCAGTGAAGGTCCCTCAGGGGAAGGAATCGAAGCACTTCTTGAGCATATTCAAAGGAAGCCTCGTGGTGCTTTTTGGTAGCAAAGATGATGATTACCAGCCGCAGAACTCCAAGAAATCGTATGAAGAAGACCAGACGCGGTTGTTCAGGGTGGAGGGAACGGAGACCGGAGTCGACATGAGAGCGGTCCAGGTGGCGGAAGAATCGAACGTTCTAGAAGATGACGACGTATTCGTTCTGGAGACCGGCAGCGGCGTCTATGTTTGGAACGGAAAGGATTCCGACCCTCAAGAACAGGAGGCGGCTCTGAAATTCGTTGAAAATGTAGTCAAGGATAAGGACGTGACGGTGGTGGAACAAGGAGACGAGCCCGAGGAGTTCTGGGAGGCTCTAGGCGGTATACCCGAAGAGAAAGAGGAGCCGTCGGCGTGGCGTATGGTTGTCAACAGACGCGTGACGGCGACACGGACCCTGACAGCTGTCAGTGTCGGCGTCGCCGGGAGGGTTAAGTTCGAGGATCTGGACACGGAATTCTCTCAGCAGGATCTTTCTGAAGATGGAGTTTATATTTTGGACACGGGCGAGGAGCTGTACTTCTGGCAGGGAGCCGACGTCACGGAACGCGTCAAATCCTCCAAACAGGAAGTCATCAAGAAGTACATAGAGGACGACGGTCTCGATCGAACCGTGGACTCGGCGGTGGTCGTGACCGTGAAGCAAGGCGCAGAGCCGCGCGTCTTCAAGAAACTATTTCCCGACTGGGACGACGGAATGTGGAGTAAACTATCATCTTATGAAGACATGAAGAATAGCACTAAAGCTGCAAATTCTAAATAG
Protein
MENPVFEEAGNQAGIEIWTIENFEPVPFDPKYYGKFYNGDSYIVLKTTEESSSLTHDAHFWLGSKTTQDKKGSAAIWTITLDDMLGGRAVHHREVQGHESSLFLSYFKPAIRYLEGGNESGFNEVQTNAGAEKRLLKLSGCDNMRIEEVAAEASSLTKNHCFILENEHDIFVLMPEGAKATQRRKIISVANKLRDEEHNGRATIEIIDEFSSDEDVNLFFETLGSGSMDELVSDDTSESYTRSDISAVYLYKVLDGDEQELVSMNKPYKQKHLASDAMYILDTGDTGVYIWLGSDLDADVKRKYHEIAGKYLEDKGYPSWVHVTRVSEGAESSTFKQYFHNWDTVRTGGSVRGIISEIDSGYFSGDAEESAAAARTIGKSATARGYMPDQGEGSLTVTRISGDQEDVTDRFQQGTSVLYQSEVYVITYKYQNENEEDAWVVYLWIGSEASDDDKEAGQMLLSQLEEDLEGNVTSVKVPQGKESKHFLSIFKGSLVVLFGSKDDDYQPQNSKKSYEEDQTRLFRVEGTETGVDMRAVQVAEESNVLEDDDVFVLETGSGVYVWNGKDSDPQEQEAALKFVENVVKDKDVTVVEQGDEPEEFWEALGGIPEEKEEPSAWRMVVNRRVTATRTLTAVSVGVAGRVKFEDLDTEFSQQDLSEDGVYILDTGEELYFWQGADVTERVKSSKQEVIKKYIEDDGLDRTVDSAVVVTVKQGAEPRVFKKLFPDWDDGMWSKLSSYEDMKNSTKAANSK

Summary

EMBL
BABH01020975    KZ150158    PZC72747.1    GDQN01009920    JAT81134.1    ODYU01004997    + More
SOQ45434.1    GDQN01006982    JAT84072.1    NWSH01000217    PCG78292.1    AGBW02011330    OWR46816.1    DS231882    EDS42860.1    GFDL01005264    JAV29781.1    GANO01002735    JAB57136.1    GFDL01005187    JAV29858.1    NEVH01006578    PNF37694.1    GFDL01005226    JAV29819.1    GFDL01005244    JAV29801.1    GFDL01005237    JAV29808.1    PNF37691.1    CH477374    EAT42359.1    EAT42351.1    UFQT01001498    SSX30817.1    EAT42358.1    EAT42352.1    SSX30818.1    CVRI01000008    CRK88567.1    ATLV01022193    KE525329    KFB47218.1    GFDF01000140    JAV13944.1    UFQS01001020    UFQT01001020    SSX08604.1    SSX28520.1    GFDF01000142    JAV13942.1    GFDF01000143    JAV13941.1    PNF37692.1    GFDF01000141    JAV13943.1    GFDF01000145    JAV13939.1    GFDF01000144    JAV13940.1    ADMH02000569    ETN65858.1    GDRN01080643    JAI62170.1    GDIQ01226848    JAK24877.1    AAAB01008966    AXCN02001122    GDIQ01189995    JAK61730.1    GDRN01080645    JAI62169.1    CH933806    EDW16986.1    KRG02434.1    HE861499    CCI71879.1    KRG02433.1    GDIQ01271127    JAJ80597.1    CH964251    EDW83060.2    GDIP01163430    JAJ59972.1    GDIP01157436    JAJ65966.1    GAKP01015189    GAKP01015188    JAC43764.1    JH431720    CH916373    EDV94564.1    EAL39527.3    HE861500    CCI71880.1    GL732524    EFX89391.1    GDIP01011124    JAM92591.1    GFDL01005406    JAV29639.1    CP012526    ALC45823.1    UFQT01000511    SSX24857.1    GDHF01015067    GDHF01010278    JAI37247.1    JAI42036.1    CM000070    EIM52893.1    GFDL01005341    JAV29704.1    CH479185    EDW37945.1    EAL28778.1    KRG02435.1    GDIQ01068363    JAN26374.1    GAMC01006570    JAB99985.1    GDIQ01035411    JAN59326.1    GBXI01005705    JAD08587.1    GAKP01015191    GAKP01015190    JAC43762.1    GDIQ01240786    JAK10939.1    GFPF01007949    MAA19095.1    CH940656    KRF78299.1    EDW58455.1    GDIP01141281    JAL62433.1    GDIP01212226    JAJ11176.1    GDIQ01187255    JAK64470.1    GGFL01005472    MBW69650.1    GAMC01012223    JAB94332.1    GDHF01032030    GDHF01001868    JAI20284.1    JAI50446.1    CH902617    KPU79940.1    GFAC01002976    JAT96212.1    LJIG01022826    KRT78520.1    GFWV01008468    MAA33197.1    EDV42840.1   
Pfam
PF00626   Gelsolin
Interpro
IPR007122   Villin/Gelsolin        + More
IPR029006   ADF-H/Gelsolin-like_dom_sf       
IPR007123   Gelsolin-like_dom       
IPR036180   Gelsolin-like_dom_sf       
SUPFAM
SSF82754   SSF82754       
Gene 3D
PDB
2FGH     E-value=2.2757e-100,     Score=936

Ontologies

Topology

Length:
751
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00111
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00004
outside
1  -  751
 
 

Population Genetic Test Statistics

Pi
18.61216
Theta
154.495009
Tajima's D
0.017031
CLR
0.405899
CSRT
0.373881305934703
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
28556443 LFPDWDDGMWSK 100.00 5e-10
28556443 ISGDQEDVTDR 100.00 5e-10
28556443 FVENVVK 100.00 7e-08
28556443 FQQGTSVLYQSEVYVITYK 100.00 7e-08
28556443 YIEDDGLDR 100.00 2e-07
28556443 VSEGAESSTFK 100.00 2e-07
28556443 NHCFILENEHDIFVLMPEGAK 100.00 2e-06
28556443 TLTAVSVGVAGR 100.00 2e-06
28556443 EVQGHESSLFLSYFK 100.00 6e-06
28556443 EVQGHESSLFLSYFK 100.00 6e-06
28556443 GIISEIDSGYFSGDAEESAAAAR 100.00 2e-05
28556443 VLDGDEQELVSMNKPYK 100.00 4e-05
28556443 VEGTETGVDMR 100.00 4e-05
28556443 VEGTETGVDMR 100.00 4e-05
28556443 GSLVVLFGSK 100.00 4e-04
28556443 GSLVVLFGSK 100.00 4e-04
28556443 EVQGHESSLFLSY 100.00 0.002
28556443 DSDPQEQEAALK 100.00 0.002
28556443 ISGDQEDVTDR 100.00 0.006
28556443 FVENVVK 100.00 0.006
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号