SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06101
Pre Gene Modal
BGIBMGA001727
Annotation
PREDICTED:_lysosomal_alpha-mannosidase-like_[Bombyx_mori]
Full name
Alpha-mannosidase      
Location in the cell
PlasmaMembrane   Reliability : 1.7
 

Sequence

CDS
ATGGTATACACGCTGCTACGTCAAGGTAGACTCTTTATCGTGGGCGGGGCATGGGGGATGGTGGACGAGGCCACCACCAACTACCACGCCGTGATCGATCAGTTCACGTACTCGCTAAGGAAACTCAACGCTACGTTCCTAGAGTGCGGGCGTCCGCTGATGGCCTGGCAGGCAGATGTCTATGGGCACTCCCGCGAGATCGCCTCGCTGCTGGCCCAGATGGGCTTCGATGGGCTCTTCATAAACCCGATCAGCTTCGACGATGAGCTGGACAGAATGAGGAGGAAATCCATGGAGTTCTTGTGGAGGGGAAGCGATGATTTAGGCGCGGAGACTGATATCTACACCCACAAGCTGTTCGACGGGTACTGGTCTCCGCCAGGGTTCTGCTTCGGGAGCTACTGCGATGACCCCCTCCTCATCACTTCGGACTCAGTCTTCAGAAACATCGACGAGCGGGTCGACCTGTTCATAAAGTCGATCCTCCACCGCCAAGCTCCCTACTACTCCACCAGGAATGTCATGGTGATGATGGGTCAGAGGTTCGGCTACTATGACGCCTCTATATGGTTCGCCAACGTGGATAAATTGATCAACGAAGTGAACAAAAAGAGTTATGAGACCGGAGCCAATATCAATCTGTATTATTCAACGCCGGCGTGCTACCTGAAAGCGGTCTATGACTCCAACCCGACTTTGGACACGAAACAGGATGACTTCTTCCCTATGGCCTACGACAAGTTCTCTCACGCCACCGGCCTGTATACGTCGCGACCCACCATAAAGTACATGGCGAGAGAGGGACATGTATACCTGCAGATGGCCAAGCAGCTTCAGGTCCTCGCCAGACTGTGGAACAACGACCAGCTCTTTGAAGAGTTTCAGTGGGTCATGGGTAATGTTTAG
Protein
MVYTLLRQGRLFIVGGAWGMVDEATTNYHAVIDQFTYSLRKLNATFLECGRPLMAWQADVYGHSREIASLLAQMGFDGLFINPISFDDELDRMRRKSMEFLWRGSDDLGAETDIYTHKLFDGYWSPPGFCFGSYCDDPLLITSDSVFRNIDERVDLFIKSILHRQAPYYSTRNVMVMMGQRFGYYDASIWFANVDKLINEVNKKSYETGANINLYYSTPACYLKAVYDSNPTLDTKQDDFFPMAYDKFSHATGLYTSRPTIKYMAREGHVYLQMAKQLQVLARLWNNDQLFEEFQWVMGNV

Summary

Cofactor
Zn(2+)
Similarity
Belongs to the glycosyl hydrolase 38 family.
Feature
chain  Alpha-mannosidase
EC Number
3.2.1.-
EMBL
BABH01020972    NWSH01000615    PCG75285.1    AGBW02010691    OWR48030.1    PCG75286.1    + More
PCG75287.1    KZ150423    PZC70926.1    GL445930    EFN88812.1    ODYU01003694    SOQ42778.1    KQ434813    KZC06792.1    KQ980167    KYN17373.1    KQ981891    KYN33784.1    CH479180    EDW28309.1    CH954177    EDV59030.2    KQ978112    KYM96921.1    ADTU01022012    ADTU01022013    ADTU01022014    GALX01000516    JAB67950.1    OUUW01000006    SPP81715.1    CM002910    KMY89556.1    GL438356    EFN69105.1    MK075175    AYV99578.1    CH902620    KPU73915.1    AE014134    AAN10754.1    KQS70602.1    SPP81716.1    SPP81714.1    KQ415041    KOC58867.1    AF145601    AAD38576.1    AAF52958.2    EDV32357.1    CM000157    KRJ97497.1    CM000361    EDX04554.1    KMY89555.1    GBXI01009935    JAD04357.1    UFQS01000218    UFQT01000218    SSX01504.1    SSX21884.1    SSX01503.1    SSX21883.1    GANO01001972    JAB57899.1    NEVH01002545    PNF42230.1    GDHF01003182    JAI49132.1    GAMC01015917    GAMC01015916    GAMC01015915    GAMC01015914    JAB90640.1    GDHF01010271    GDHF01002021    JAI42043.1    JAI50293.1    GDHF01030990    JAI21324.1    GDHF01027225    GDHF01012263    JAI25089.1    JAI40051.1    GDHF01010454    JAI41860.1    GBXI01004996    JAD09296.1    KK107648    QOIP01000008    EZA48346.1    RLU19783.1    CVRI01000038    CRK93802.1    GAKP01021245    JAC37707.1    CH940649    EDW63296.2    PNF42229.1    CH933807    EDW13347.1    JXJN01006781    GFDL01006180    JAV28865.1    KRG03704.1    GL762576    EFZ21090.1    GFDL01006179    JAV28866.1    ODYU01002940    SOQ41072.1    CP012523    ALC39282.1    CH916372    EDV98984.1    CRK93801.1    PYGN01000082    PSN54844.1    CH963857    EDW76035.2    AAAB01008944    CH477358    EAT42739.1    KQ435775    KOX74960.1    KRF81022.1    GAPW01000098    JAC13500.1    NWSH01004815    PCG64677.1    GFDF01005288    JAV08796.1    AJVK01005894    AJVK01005895    GFDF01005289    JAV08795.1    AXCM01004170    ATLV01012389    KE524787    KFB36708.1    JXUM01075505    KQ562889    KXJ74905.1    MK075237    AYV99640.1    EAL40242.3    GAPW01000077    JAC13521.1    KK853110    KDR11229.1    APGK01026882    KB740648    ENN79713.1    ADMH02000752    ETN65164.1   
Pfam
PF01074   Glyco_hydro_38N        + More
PF17677   Glyco_hydro38C2
PF09261   Alpha-mann_mid
PF07748   Glyco_hydro_38C
Interpro
IPR028995   Glyco_hydro_57/38_cen_sf        + More
IPR027291   Glyco_hydro_38_N_sf       
IPR037094   Glyco_hydro_38_cen_sf       
IPR000602   Glyco_hydro_38_N       
IPR011330   Glyco_hydro/deAcase_b/a-brl       
IPR041147   GH38_C       
IPR015341   Glyco_hydro_38_cen       
IPR011013   Gal_mutarotase_sf_dom       
IPR011682   Glyco_hydro_38_C       
IPR013780   Glyco_hydro_b       
SUPFAM
SSF88688   SSF88688        + More
SSF88713   SSF88713       
SSF74650   SSF74650       
PDB
1O7D     E-value=1.71805e-38,     Score=398

Ontologies

Topology

Length:
301
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.164310000000001
Exp number, first 60 AAs:
0.11201
Total prob of N-in:
0.04607
outside
1  -  301
 
 

Population Genetic Test Statistics

Pi
364.680997
Theta
196.743048
Tajima's D
2.560326
CLR
0.010169
CSRT
0.951402429878506
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号