SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06084
Pre Gene Modal
BGIBMGA006220
Annotation
PREDICTED:_uncharacterized_protein_LOC101745617_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 4.291
 

Sequence

CDS
ATGAAGACTGGTGGCGGACAGTGTATTCCAAATGAGCCACAGCCTGGTAGCAGCAATGAGACCCTTATTTTTGCTGAGGTTCTACTGGATCAGACTGATGTGGAACTCAGGGGTGTCATTGACAGTGATACCATTTACAGTTCTGAAGATATTGCAATGGAGCTTGAATCATCAGTTCCAGCAGCAGCGCAACCACAACAGAATGATGAAGTTCTGAGTGTAAGCTGTGCAAGATCATCAGCTGAAGAATACCAAAGTGTGAACACTCATATGCATCTTATGGGGTCCCATCTTACAGTTTGTGGTGGAGCTTCATCACAAGGAAATGTTGCAGGCACCACGCCTATGCATTACAGTCTATCATGTCGTGACACCCCACAACGTCGTGATACTCCACCACGTCGTGACACTCCACCCAGTCGTGACACTCCACCAAGTCGTGACACTCCACCAAGTCGTGACACTCCACCAAGTCGTGACACTCCACCATGTCGTGACACTCCACCCAGTCGTGACACTCCACCAAGTCGTGACACTCCACCACGTCGTGACACTCCACCGCGTCGTTCTGGGTCCCGGCAGACTGACTGTGGTGCAGCCTCCTTAGGAGGAGGGAATGTGCGCACCAGGGTAATTCAGGAGGAATTTAATTTTAGAAAAGAATCTTATGAAAAGAAAGAGAGAAGAGAAGACGAACTCTTTCAATTCCAAAAAAAGGAAAGAGAGTGGATGATGAAGGCAGCCGAAGAAGTATATCTAAAAGCGAAGGCTGAGAGGGAAGCTGCAGAGGATATTAAAAAATATAATCAGGCTAAAAGAGATTGTAGTGAAAAATAA
Protein
MKTGGGQCIPNEPQPGSSNETLIFAEVLLDQTDVELRGVIDSDTIYSSEDIAMELESSVPAAAQPQQNDEVLSVSCARSSAEEYQSVNTHMHLMGSHLTVCGGASSQGNVAGTTPMHYSLSCRDTPQRRDTPPRRDTPPSRDTPPSRDTPPSRDTPPSRDTPPCRDTPPSRDTPPSRDTPPRRDTPPRRSGSRQTDCGAASLGGGNVRTRVIQEEFNFRKESYEKKERREDELFQFQKKEREWMMKAAEEVYLKAKAEREAAEDIKKYNQAKRDCSEK

Summary

Uniprot
ProteinModelPortal

Ontologies

GO

Topology

Length:
278
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00219
Exp number, first 60 AAs:
0
Total prob of N-in:
0.03180
outside
1  -  278
 
 

Population Genetic Test Statistics

Pi
301.477393
Theta
156.342741
Tajima's D
3.167416
CLR
0
CSRT
0.987000649967502
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号