SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06054
Annotation
PREDICTED:_uncharacterized_protein_LOC106136887_[Amyelois_transitella]
Location in the cell
Nuclear   Reliability : 1.887
 

Sequence

CDS
ATGGCGACAAAGCGGTCCACAGCATTGCTGGCTACAGCATTGATAACTGTTAAGAATAGTACAGGACATTATACAGTATTGCGCGCCTTAATAGATCAAGGGTCACAGGCTAATTTTATTAGTGAAAGAGCAGTACAACTTTTGAAAGTCAAAGGAACACCCACTAAGGGGACAATCACTGGAGTTGGATCTACACAAACGGAAGTAAATCTCGCAGTCCAGCTTGAAATATTATCTAGATACAAATGCAATTTCAAGCTCAACGTGGAAGCATATGTGATGCCTTCACGTTTAACAACATACTTACCGTCCACAACTATTGCCGACTCCACACTCACCTGGTCGCATTTGAAAGGTCTCAAGCTGGCAGATCCCACCTTTAATCAACCAGGGAGAGTTGATATGCTTCTAGGTGTAGAAGTATATGCAGCCATTCTGAAAAATGAAGTTATTCGAGGTCCTCCTGGCTCACCATGCGCACAACATACAAGTTTTGGATGGATTCTCTTTGGAAGGATACACAATGACATTGAAGAAAGGAAAATTACAGTTATGCACCACCACATGGATTTTGATGAAATTTTACACACACTATGGGAGTTAGACTGTGATAATCAAAGAAAACTTACACAAGAAGAGGAACTCTGTGAGAACATTTATTCTGAAAATGTTAGGAGAGACAATGAAGGAAGATACATTGTGAAATTACCTTTTAAATCAGATGTCATACTAAGTACAGAAGGTAATACCAGGGATATAGCACTAAGAAGATTAACACAACTAGAGAGAAGATTACAGAGAGACATGAAGTTAAAGACAGAATACACTAAAGTGATGCAAGAATATATTGAATTGAATCATATGGAAGAAGTACCAGAAGAAGAATTAGGGAAACCCTCTGTCTACCTTCCTCATCATGCAGTTGTAAAGGATACAAGTGAGACTACCAAAGTAAGAACTGTGTTCAATGCCTCCTCAATGGGATCTAATAATGTTTCCATTAATGATGAGTTACTAGTTGGCCCACAATTGCAAGAAGACATGAGATCATTGGTTATGAGATGGAGACTAAAACGAGTTTGTTTCATAGCAGATATTGAGAAAATGTATCGGCAGATATTGGTTACCAAACAGGATGCAGATTACCAACGAATCTTGTGGAGAATTGATCCAAATCTTAAAGTCAAAGATTACAGATTGCTTCGGGTAACATTTGGAACTGCTTCGGCTCCGTTCCTTGCTGTAAGAACTCTACAACAAGTTGCAGAAGATGAAGGCAAAGATTTCCCTGAAGCAACTCAAATAATTAAGGAAGACTTCTGGATGGATGACTTATTATCTGGTAACGATACAGTAAGTGAAGCCATTGAATCAGCGAGAAATGTTAGTGACATCTTGAATCGTGGCGGTTTCAAATTACAAAAATGGTCTTCTAACAGTATTGAATTTATGAAAAATATTTCACCTACAGAAAGAAGTACATTGATAAATGTGGATATGAACCTGGGAGGAACTGTTAGAACATTGGGGTTATCATGGAATATAGGAGATGATGTGCTACAGTATAATCTTAATTTGCCAGAAGTGCCACTTACCATTACTAAGAGAAGTATACTTGCTGAGATACAACGCTTATTTGATCCACTTGGTTGGATAGCACCTGCCTTGTTACCTGGAAAACTAATAATACAAAGACTATGGTTGAAAAGACTTACCTGGGATGAAGAAGTAGACTCTGAAACTAAAAGAGATTGGTTAGAGATGAGAAACAACTTAAATTATTTAAAGGAAATTAAAATACCACGCTGGTTACTTATTACTAGTGATGTCATAGAAGATGTGTCAATACATGGATTTTGTGATGCATCAACAATTGCATATGGAGCAGTTGCTTACCTGAGAGTCAAAACTTACAATAATGAATATAAAACTATGCTGATAGCAGCGAAGACTAGAGTCGCACCTGTTAAACCAGTCTCACTGCCCCGTTTGGAACTGTGCGGTGCGGTGTTATTATCAAAGCTCTTGAAACACATCAGTCGTGCTACACGGATACCAAGGAAACAAATCTTTGCTTGGACAGATTCTACCATAGTACTATCATGGCTTACTGGAGACCCGACGAGATGGCAAACATTTGTGAGAAATCGTGTAGTAACAGTGCTTGACAATATTGGAAATGCATGGTATCATGTACAGTCTCAAGACAACCCTGCAGACATAGCATCAAGAGGAATGCTTCTTTCAGATCTCAAAGAATTTAGTTTATGGTGGAACGGCCCTAAATGGCTCACCCATGAAGAAATATTGATGTCTCGCGGAGATAATATTTCTACTGACCTAGAGTTGAGAAGAACAATTATCAATACAAACATAAAAATAGACAATAATCATAATGAAGGAAATTATATACACAATCAATTTGAAAACTTTAACAACTTGATGGAACTACAAAGAACTATTGTGTACTGCAAAAAATTCTTGAATTTTAAACGAAGTAGCGATAACATTAGTACAAAGTGCTTCAGCCCACTGGAGTTAACAGAGGCTCTTGAAACATGTGTGCGGTTAGCACAACATAATGATTTTGAACATGAAATCCACGATTTGTTACAAGGGACTGGAGTAAGTAATAGAAGTGTACTGAAGAATCTCAATCCTTATCTAGACAAGAAAGGTCTTCTCAGAGTAGGCGGTCGATTACGAAATGCGGAAATGGAAAATGACGCTAAATATCCTATGATCATAAATCAAGATTCTGGATCATAA
Protein
MATKRSTALLATALITVKNSTGHYTVLRALIDQGSQANFISERAVQLLKVKGTPTKGTITGVGSTQTEVNLAVQLEILSRYKCNFKLNVEAYVMPSRLTTYLPSTTIADSTLTWSHLKGLKLADPTFNQPGRVDMLLGVEVYAAILKNEVIRGPPGSPCAQHTSFGWILFGRIHNDIEERKITVMHHHMDFDEILHTLWELDCDNQRKLTQEEELCENIYSENVRRDNEGRYIVKLPFKSDVILSTEGNTRDIALRRLTQLERRLQRDMKLKTEYTKVMQEYIELNHMEEVPEEELGKPSVYLPHHAVVKDTSETTKVRTVFNASSMGSNNVSINDELLVGPQLQEDMRSLVMRWRLKRVCFIADIEKMYRQILVTKQDADYQRILWRIDPNLKVKDYRLLRVTFGTASAPFLAVRTLQQVAEDEGKDFPEATQIIKEDFWMDDLLSGNDTVSEAIESARNVSDILNRGGFKLQKWSSNSIEFMKNISPTERSTLINVDMNLGGTVRTLGLSWNIGDDVLQYNLNLPEVPLTITKRSILAEIQRLFDPLGWIAPALLPGKLIIQRLWLKRLTWDEEVDSETKRDWLEMRNNLNYLKEIKIPRWLLITSDVIEDVSIHGFCDASTIAYGAVAYLRVKTYNNEYKTMLIAAKTRVAPVKPVSLPRLELCGAVLLSKLLKHISRATRIPRKQIFAWTDSTIVLSWLTGDPTRWQTFVRNRVVTVLDNIGNAWYHVQSQDNPADIASRGMLLSDLKEFSLWWNGPKWLTHEEILMSRGDNISTDLELRRTIINTNIKIDNNHNEGNYIHNQFENFNNLMELQRTIVYCKKFLNFKRSSDNISTKCFSPLELTEALETCVRLAQHNDFEHEIHDLLQGTGVSNRSVLKNLNPYLDKKGLLRVGGRLRNAEMENDAKYPMIINQDSGS

Summary

EMBL
ODYU01008608    SOQ52337.1    RSAL01000327    RVE42512.1    KQ458473    KPJ05885.1    + More
KQ461175    KPJ07794.1    KQ460036    KPJ18393.1    GAKP01007887    JAC51065.1    LNIX01000036    OXA39969.1    GEZM01060254    JAV71154.1    GAMC01003146    JAC03410.1    GBBI01004211    JAC14501.1    LBMM01008324    KMQ88972.1    LBMM01010405    KMQ87487.1    LBMM01008464    KMQ88855.1    LBMM01010417    KMQ87475.1    LBMM01005506    KMQ91466.1    GFTR01008874    JAW07552.1    LNIX01000007    OXA51382.1    LBMM01011283    KMQ86917.1    LBMM01007859    KMQ89359.1    LBMM01009888    KMQ87813.1    LBMM01009964    KMQ87756.1    LNIX01000002    OXA60848.1    LNIX01000069    OXA36894.1    LBMM01012077    KMQ86420.1    GEZM01066274    JAV68017.1    QOIP01000009    RLU19024.1    GALX01004947    JAB63519.1    LBMM01011492    KMQ86800.1    LBMM01012238    KMQ86334.1    LNIX01000016    OXA46198.1    GEZM01066272    JAV68024.1    AJ487856    CAD32253.1    LNIX01000001    OXA61293.1    LNIX01000044    OXA38660.1    LBMM01006539    KMQ90520.1    LNIX01000003    OXA58579.1    OXA59522.1    AY180917    AAN87269.1    OXA51795.1    LBMM01011516    KMQ86784.1    LBMM01009645    KMQ87967.1    LBMM01012188    KMQ86362.1    GEHC01000939    JAV46706.1    LBMM01009551    KMQ88039.1    LBMM01009898    KMQ87805.1    ABLF02042806    LBMM01009746    KMQ87900.1    JXUM01030959    KQ560903    KXJ80414.1    ABLF02042264    LBMM01009496    KMQ88090.1    GGMR01020322    MBY32941.1    GEHC01000864    JAV46781.1    GGMS01004301    MBY73504.1    LBMM01009688    KMQ87939.1    GAMC01020552    JAB86003.1    GGMR01005535    MBY18154.1    LBMM01011051    KMQ87060.1    GBBI01004139    JAC14573.1    ABLF02022040    ABLF02056888    GBBI01004140    JAC14572.1    LBMM01009210    KMQ88303.1    JXUM01113346    KQ565681    KXJ70776.1    GBGD01000063    JAC88826.1    GEHC01000869    JAV46776.1    DNYX01000039    HBK82233.1    ABLF02041731    NWSH01000070    PCG79985.1    GEZM01012999    JAV92824.1    KK114194    KFM61875.1    LBMM01011781    KMQ86634.1    GAMC01021577    GAMC01021573    JAB84982.1    ABLF02016109    ABLF02016113    LBMM01009212    KMQ88302.1    GBXI01011257    JAD03035.1    ABLF02022912    ABLF02038819    ABLF02051942    ABLF02060282    LNIX01000011    OXA48901.1    OXA48427.1    LBMM01016286    KMQ84479.1    LBMM01016285    KMQ84480.1    KZ150008    PZC75149.1    GGMS01010815    MBY80018.1    GGMR01017803    MBY30422.1    GAMC01006864    JAB99691.1    GGMR01018506    MBY31125.1    GANO01004788    JAB55083.1    LNIX01000005    OXA54454.1    GGMR01010750    MBY23369.1    GEZM01085145    GEZM01085143    JAV60187.1    LBMM01012146    KMQ86385.1    ABLF02041505    ABLF02004142    LBMM01007770    KMQ89434.1    ABLF02022909    ABLF02042631   
Pfam
PF17921   Integrase_H2C2        + More
PF05585   DUF1758
PF03564   DUF1759
PF05380   Peptidase_A17
PF18701   DUF5641
PF00008   EGF
PF00078   RVT_1
PF00665   rve
PF02145   Rap_GAP
PF12259   Baculo_F
PF00230   MIP
PF17919   RT_RNaseH_2
PF17917   RT_RNaseH
Interpro
IPR001584   Integrase_cat-core        + More
IPR012337   RNaseH-like_sf       
IPR008042   Retrotrans_Pao       
IPR001878   Znf_CCHC       
IPR008737   Peptidase_asp_put       
IPR040676   DUF5641       
IPR005312   DUF1759       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR000253   FHA_dom       
IPR000742   EGF-like_dom       
IPR011042   6-blade_b-propeller_TolB-like       
IPR013032   EGF-like_CS       
IPR021109   Peptidase_aspartic_dom_sf       
IPR000033   LDLR_classB_rpt       
IPR000477   RT_dom       
IPR001995   Peptidase_A2_cat       
IPR001969   Aspartic_peptidase_AS       
IPR036875   Znf_CCHC_sf       
IPR000331   Rap_GAP_dom       
IPR035974   Rap/Ran-GAP_sf       
IPR022048   Envelope_fusion-like       
IPR000727   T_SNARE_dom       
IPR000425   MIP       
IPR023271   Aquaporin-like       
IPR041373   RT_RNaseH       
IPR041577   RT_RNaseH_2       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF57756   SSF57756       
SSF111347   SSF111347       
SSF81338   SSF81338       

Ontologies

Topology

Length:
922
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.35071
Exp number, first 60 AAs:
0.33026
Total prob of N-in:
0.01591
outside
1  -  922
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
22.659727
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号