SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06028  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA002831
Annotation
PREDICTED:_probable_elongator_complex_protein_2_[Papilio_xuthus]
Full name
Probable elongator complex protein 2      
Alternative Name
Stat3-interacting protein homolog
Location in the cell
Cytoplasmic   Reliability : 1.852
 

Sequence

CDS
ATGGAACATACGGTACAAAATACAGAGGGAACCGAAGTCCCTCCGCAGACCCAGAGGTTCCAAACGATCCGTGAGAATGGGATTATCGACAATCCGAACGGCCCTCCTCTGTATGGAGTCAAATGGAAGAAGCTGGTATTTGGGAGCCCCGGCCCAGAGATGGGAGCAGTACTCCACGCGAGGCCGGACTTGTGCTTTATAAAGCAAAAGTCTTTGTCCAGGCGTGAAGTACCGCTTCGCTCTGTTGAGGACTCCCAGCATTTTGGACGCCAACTTGGCTTTGCCTTCCAAATGACTCCGAAACTGGACATCGCTCGAAATGTCGACCCCAAGTATCCCAATACTCTCGGAAGGTTGCAGGGATACTCCTTGGAATTGCGGCGCCATGACAAAGGGGTGTCTGTAGAACAAGTGTATACATCTGTCGCCTGTAACCGCAAACCTGAAGTGGTAGACTGGAATTACGACGGGATAATTTGTTACGGTGCCTGTAATGCTGTTGTTGTTTGTGATCCGAATGAAAAAACTAAAGATAGAGTAACAGTACTGAGTCACCATACAGGACACGTAAACTCTGTAAAATGGATACACAATCATAATGGCCAAACAACAGAGTTGCTCTCTTGCTCAGTTGATAAGACTGCTGTCATCTGGACATTACAAAACGGTTGCTGGAACGTCACCAGTATTCTCAAGGGACATACAGAAGGAGTTACTAATATATATGGAAATTACCATAGAGACCGACTTACTATTTACACTGCGTCCACTGATTCTACCATTAGAGTTTGGGAAAGGATAGAAGGTACGGTAACCCTCAAGCAAAGTATATCTCTACATTCTGGTTTATGTCTCACCCTTCACGCGCAAATACTACCATGCGCAAATAAACCGCTATTACTTTGTGCACTGGATGACCACAAAATACATATATTCGTTGGTGAGGACTATCACAGAGCGCATACTCTGGTTGGACACGAAGACTGGGTTAGGGGACTTGACGTGTTGGAAGTTGATAACGACACAATTATCGTAGCGTCGGCTTCTCAAGATACATACATTCGTCTGTGGAAGATACAAAAGGTCAAAGCACAACCGGAGTCCAAACTGATTAAGGTTGAGGAAAAAGTGTTCCATGCATATGACAATCTTTGGTCTGTGAAACTTGAGGCAGTGCTTGCCGGTCATGAAGCCTGGGTCTATGGGGTACAATGGCATCCTTATAGTTTTGATGGTCCTACTAAAAAGCCGGTATACCGTCTCCTGTCATCATCACTGGACAAAACCCTGATTATTTGGGAGCCAGACTCCAGTAGTACAGACGAAGGTGTCTGGGTAGAGAAGGTCAGGGTGGGCGAAGTGGGAGGCGGAGGCTTGGGTTTCTACGGGAGCCGTTTTGGACCAGAAGGTATGTCCTTCTTGGGACATGGTTACAATGGCTCTTTTCACATTTGGACTTTTGATAAGGAAAGTGAGCAGTGGTCCCCGAGCGTGGTGTGCGGCGGACACTTCATGTCGGTGGAGGACGTCGCCTGGGAGCCGCGCCAGGGCCGCTACCTGCTCAGCGTCTCCGCAGACCAGACCACGAGACTCCACGCCCCGGTCCGGAGGAGCGATGGTTCCGTGGCCTGGCACGAGCTGGCCCGGCCGCAGATCCACGGCTACGACATGTCGGCCGTAGCCCCCCTCACCGCCACCACCTTCGCGTCCGCCGCCGAGGAGAAGGTCATCAGGGTCTTCACAGCACCGCACAACTTCATCAGCAATTTCAAGAACCTCGTGGGAGAAGTCCTCGTCGCAAATAACGAGAAAGGTCCGGAGGGCGCTTCGGTCCCCTCGCTGGGCTTGTCCAACAAGGCCGTGTTCATAGAGGAGCAGGGCGGCTCAGGCGCCGGTGACGACGGCGACGGCTACTTTGCGCCCGTCGATATGAAAGAGCCGCCCACTGAGGAGACGTTGGTCCAGAACACGCTGTGGCCGGAGCTGCAGAAGCTGTACGGGCACGGCGGGGAGGTGTTCGCGCTGCACGCCGCGCCCGACGGGACCCTGCTCGCCTCCGCCGCCCGGGCCACCGACGCCACGCACGCCGCGCTCGTGCTGTGGGAAACCGCGAAATGGCAGCAAATACAAAAGATAGAGTCCCACACGCTGACAATAACGCAGCTCGCGTTCTCGCCGGACAGTCAGAAGTTATTGTCCGTGTCTCGGGACCGGCGCTGGACGCTGTACCGCCGGCTGCCGGGGTCTAGCAGGTTCGAGGTGGCCGCCACCAGCGACAAGAGCAACGGCGTGCACTCCAGGATCGTGTGGTGCTGTGCGTGGGCTCCCGACGCGCGCATGTTCGCCACCGGCTCCAGGGATGGCAAGGTCTGTTTGTGGGCGAAATCAGATACGTGCACCGACACGTCGCTAAAGGAGTACGCGCTGCACGGGAGCCCTCTGGAGGCCGGCGCCTCCGTGACGGCGCTGGCGTGCACGGGGCGCGGGGAGCGCTGCGTGCTGGCCGTGGGGCTGGAGACGGGCGCCGTCGACATATACAGGGCAGACGACTGGCGCCTCCTGCACCGCATGGACCACAGCTCGGCGCATCACCTGACCGTGAAGAGGTTAACATTTAATCCAAAATATGAGGGTAGCGATGAAACGTTGTTGGCGAGTGCGGGCGCCGATCACGTCGTGAGGATACATCGCCTCAAAATAACTTATTAA
Protein
MEHTVQNTEGTEVPPQTQRFQTIRENGIIDNPNGPPLYGVKWKKLVFGSPGPEMGAVLHARPDLCFIKQKSLSRREVPLRSVEDSQHFGRQLGFAFQMTPKLDIARNVDPKYPNTLGRLQGYSLELRRHDKGVSVEQVYTSVACNRKPEVVDWNYDGIICYGACNAVVVCDPNEKTKDRVTVLSHHTGHVNSVKWIHNHNGQTTELLSCSVDKTAVIWTLQNGCWNVTSILKGHTEGVTNIYGNYHRDRLTIYTASTDSTIRVWERIEGTVTLKQSISLHSGLCLTLHAQILPCANKPLLLCALDDHKIHIFVGEDYHRAHTLVGHEDWVRGLDVLEVDNDTIIVASASQDTYIRLWKIQKVKAQPESKLIKVEEKVFHAYDNLWSVKLEAVLAGHEAWVYGVQWHPYSFDGPTKKPVYRLLSSSLDKTLIIWEPDSSSTDEGVWVEKVRVGEVGGGGLGFYGSRFGPEGMSFLGHGYNGSFHIWTFDKESEQWSPSVVCGGHFMSVEDVAWEPRQGRYLLSVSADQTTRLHAPVRRSDGSVAWHELARPQIHGYDMSAVAPLTATTFASAAEEKVIRVFTAPHNFISNFKNLVGEVLVANNEKGPEGASVPSLGLSNKAVFIEEQGGSGAGDDGDGYFAPVDMKEPPTEETLVQNTLWPELQKLYGHGGEVFALHAAPDGTLLASAARATDATHAALVLWETAKWQQIQKIESHTLTITQLAFSPDSQKLLSVSRDRRWTLYRRLPGSSRFEVAATSDKSNGVHSRIVWCCAWAPDARMFATGSRDGKVCLWAKSDTCTDTSLKEYALHGSPLEAGASVTALACTGRGERCVLAVGLETGAVDIYRADDWRLLHRMDHSSAHHLTVKRLTFNPKYEGSDETLLASAGADHVVRIHRLKITY

Summary

Description
Acts as subunit of the RNA polymerase II elongator complex, which is a histone acetyltransferase component of the RNA polymerase II (Pol II) holoenzyme and is involved in transcriptional elongation (By similarity). Involved in the regulation of the STAT pathway.
Cofactor
Zn(2+)
Subunit
Component of the RNA polymerase II elongator complex (Elongator). Elongator associates with the C-terminal domain (CTD) of Pol II largest subunit.
Similarity
Belongs to the WD repeat ELP2 family.
Belongs to the peptidase M3 family.
Keywords
Complete proteome   Cytoplasm   Nucleus   Reference proteome   Repeat   Transcription   Transcription regulation   WD repeat  
Feature
chain  Probable elongator complex protein 2
EMBL
KQ459472    KPJ00191.1    ODYU01010033    SOQ54852.1    GAIX01004112    JAA88448.1    + More
AGBW02004392    OWR55405.1    KQ461186    KPJ07376.1    KK853329    KDR08420.1    AE013599    AY052019    CM002911    KMY92838.1    CM000362    EDX06522.1    CH954179    EDV56586.1    CH480816    EDW47290.1    CH479183    EDW35500.1    CM000071    EAL26326.1    NEVH01021926    PNF19328.1    CM000158    EDW90098.1    OUUW01000001    SPP74138.1    CH902619    EDV38068.1    GEZM01055123    JAV73126.1    CH916367    EDW01131.1    CH940648    EDW61755.1    GEDC01008629    JAS28669.1    CH963848    EDW73824.1    PNF19332.1    CP012524    ALC40621.1    APCN01003655    JRES01001351    KNC23456.1    AAAB01008807    EAA03956.4    CH933808    EDW08843.1    CH477319    EAT43673.1    DS232330    EDS40144.1    CCAG010018439    GGLE01002324    MBY06450.1    ADMH02002185    ETN57929.1    GEDV01008744    JAP79813.1    GACK01005189    JAA59845.1    UFQT01000246    SSX22350.1    AXCN02000560    ABLF02017489    ABLF02017490    AXCM01002307    JXUM01091356    JXUM01091357    KQ563907    KXJ73085.1    JXJN01023720    UFQS01001398    UFQT01001398    SSX10691.1    SSX30373.1    KQ971372    EFA10370.2    GFWV01007565    MAA32295.1    NNAY01001755    OXU23027.1    AMQN01010605    KB308219    ELT98174.1    KQ434786    KZC05189.1    GG666612    EEN49497.1    GGMR01001385    MBY14004.1    GFXV01002083    MBW13888.1    GGMR01006321    MBY18940.1    GECL01002476    JAP03648.1    HACG01031834    CEK78699.1    LBMM01004441    KMQ92418.1    AADN05000026    GFAA01001157    JAU02278.1    LSYS01008581    OPJ68426.1    GL437711    EFN70014.1    GFTR01008042    JAW08384.1    GFAC01000831    JAT98357.1    MRZV01001176    PIK40001.1    KC207886    AGC50884.1    CM004477    OCT74375.1    GBBI01003812    JAC14900.1    JO842437    AEO34054.1    KZ288425    PBC25940.1    BX927389    RJVU01057109    ROK35835.1    PNF19329.1    BC164575    AAI64575.1   
Pfam
PF00400   WD40        + More
PF01432   Peptidase_M3
Interpro
IPR036322   WD40_repeat_dom_sf        + More
IPR037289   Elp2       
IPR017986   WD40_repeat_dom       
IPR001680   WD40_repeat       
IPR015943   WD40/YVTN_repeat-like_dom_sf       
IPR020472   G-protein_beta_WD-40_rep       
IPR011047   Quinoprotein_ADH-like_supfam       
IPR019775   WD40_repeat_CS       
IPR024077   Neurolysin/TOP_dom2       
IPR033851   M3A_MIP       
IPR001567   Pept_M3A_M3B       
IPR011041   Quinoprot_gluc/sorb_DH       
IPR011048   Haem_d1_sf       
SUPFAM
SSF50978   SSF50978        + More
SSF50998   SSF50998       
SSF50952   SSF50952       
SSF51004   SSF51004       
Gene 3D
PDB
5M2N     E-value=1.42275e-66,     Score=646

Ontologies

Topology

Subcellular location
Cytoplasm  
Nucleus  
Length:
902
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00205
Exp number, first 60 AAs:
0.00016
Total prob of N-in:
0.00013
outside
1  -  902
 
 

Population Genetic Test Statistics

Pi
20.544788
Theta
17.204113
Tajima's D
0.249421
CLR
0.387959
CSRT
0.450277486125694
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
25044914 IVWAIGGTHIVVTGFDK 100.00 0.002
27102218 IESHTITITQIAFSPDSQK 100.00 0.002
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号