SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06025
Annotation
PREDICTED:_uncharacterized_protein_LOC106708887_[Papilio_machaon]
Location in the cell
Nuclear   Reliability : 1.697 PlasmaMembrane   Reliability : 1.217
 

Sequence

CDS
ATGTCGGTGTCCTACATTCGCGGGAAGGTGACTAGTGAGCTCCGATGGTTCGCATCAGCTCATGCTTTGGTTGACAGAACGGATAGGGATGCGGCATTGCTCGATAGGGCGTCTCAGGTGCACGAACGGTTGGAGGTAGTGTACGATCGGTTGTCTGACCTCGTTGCTTTGGGGTCCGAAGTGGAGAAGGAGGTGATCCATGCCATCGGTCTTGACGTGGACCAGTGTCAGGAGTACGCTGATGCCATTCTGCAACGGGTGGCCGATATTAAGAAGCAGTCGGCTTCCGGTGGTAATGGAGGTTCGGGAACTTCGTCAGGCGTCATATCACGCCTCCCCTCCATCGACCTGCCGATCTTCCACGGTGATCTGAACGAGTGGGTCGGCTTTAAAAATTTGTTTGACAGCCTGGTCCATGGTCGGTCGGACTTGACTGCCTCGTATAAGATGGCTCAGCTTCGGGGTGCTCTGCGAGGTGAACCTGGTGAATTGGTGGCACACTTGCCTATCACCAACGACAATTATGCGGTCGCACGCCAGATCCTGTTCGACCGATATCAAAATCAACGACGGTTGGTAGACGCTCAGCTGGCCAGGCTGTTTGCGATACCCAAACTTTCTCGGGCGTCCGATATCAGAACCGAGGTACTGAATCCAGTTACGGTGGCCACTAAGGCCTTGGGCAATTTGGGTCTACCAGTAGACCAATGGTCATATCTGCTCTTTTATATTGTTGCAGGTAGGCTGCCGGTTGAGGTGCTCACTCGCTTCGAGCAGCAGGACAACGCAGGTAGGGACGAACTGCCTACCCTGGCCAATCTGCTGGCATTTTTAGAAGCCGAAAGTCGCAGACACGAGATTATGCCACCACCCTCCTCTGGGTCGCGTGTGCCGGCTTCCGGCCACGCCGTTTCGGTTGCTCAGAGGGGAGGGGGAGGGGATAAGAGGGGGCCGTCTCAACGACTGACTGCGCTCATGGCAGCGGTGGGAGGCCCACGGTGTGCCTTCTGTCATGAGAGCGGGCACGACGTAGCCGCCTGTCCGAGGTTCCGGTCGACGCGCATCAGGGGTAGACGCAACATCGTTGCCCAGCGGCGATGGTGCTTTTTTTGTTTTGGGCCGCACACGGCGAGCGTCTGTCCACAGCCACAATTGTGCCCTAATTGCGACGGTCGGCACCATGCCCTCCTGTGTCTGGAGTCTGCCGCCACTCCGAGGTCATCCGGACGCAGTCATCTAGCCTCGCCGACCGGTGAGCGCACCGGTCGTAGCCCTCGCCAATTTGGCGGCGTGGACCCTCGGGAAGAGGCTTCGCAGGGAGGCGCCGGGTTAGAAGCTGTTTTACTTCCTACCGCTTCTGTTCGGGTGTTGGATTCGGATGGCAACACTGTGTTTGCTCGAGCTCTGTTGGATTCCGGCGCACAGGGCAGTATTATGTCGAGCAACCTTGCAGTACGGTTGGGCAATCCTATTTACAAGTCTTCTTATTCTATTCGTGGAGTGGGCAATGTTAGAATTTCGGACGTGATCGGTCACACTTCATTTATTTTCTCATCGAATCCCAACCCTCGCTTACAGTTTAGAGTCTCAGCTTTGGTGATGCCTGAGGTGATAGGTCGTCACCCTCCGGTGAAGGTAAACAGTTACATACGGTCATTGACTTCAGACTTACGGCTAGCGGACCCCAAGTTTGACACCCCGGGGCCAGTAGACGTACTACTTGGGGCGGATGTACTAGGGAAGCTGCTCCTGACTGGGAAGCGCGTTCTTCATGCGGAGGGTTTGGTTGCAATGGACACAAAATTAGGGCATGTATTGTTGGGTCCTGCGTTCCGGCCGGTCGCTGCGAGGAAATCGGACAATTTTCTGGTCGGGTCTACGCTTTCGGAAGTAGTCCAACGGTTTTGGGAACTAGAAGAACCTCCTACAGCTTATCGAGTTAACCCGGATGAGGAGGAATGTGAGCTGTTTTACCAGAATAATACGGGTCGTCTCTATTCGGGCCGGTTCTTGTTAAGACTTCCTTTTCGGGCGAATCGCCCACTGCTAGGCAGTTCGAGGAAGGCAGCAGAGACTAGACTTTTGTCAATGGAGAGACGCATGAGGCGCGACGCGGTGTTCCGGCAGAAATATGTAGAGTTTATGCGGGAGTATGAATCCTTAGGTCACATGTCGGTTTCCAAGGTAGATTGGAGTGCTACGGAGCACTGTTTCCTGCCTCATCATGCGGTTTTGAAAACTCCTAACGGTAAAATTAGGGTCGTGTTTGACGGTTCGGTCACGACCTCCTCCGGCGTCTCGTTAAATCAGTGTCTCCATTCGGGTCCAAAGCTGAACCGGGACATTTCAGACATACTGACGAGCTTCCGCAGGCACCAGATCGTTTTCGTGGCAGACATCCGTATGATGTTCAGGCAAACGGTGATTCATCCGGAGGATAGGCGGTATCAACTCATTCTCTGGCGTGAAAGCTCAGATGAGCCCATAAAAATTTATGAACTGAACACGAACACTTACGGGTTGCGGTCGAGTCCATATTTAGCCCCCCTCACGTCGGTGACCTTGTGTTGGTTAAGGATGCTAACCTGCCGCCACTGCGTTGGCGTAGGGGGCGCATTGTTAATCTGTTTCCCGGTAAGGATGGGACCCCTCGGTCTGCAGAGGTTCTGGTCGGGGACTCGGTTCTCAAACGAGCGGTCACAACGTTGTCCCGGCTGCCAGTTGATTAGGGACAGGTAG
Protein
MSVSYIRGKVTSELRWFASAHALVDRTDRDAALLDRASQVHERLEVVYDRLSDLVALGSEVEKEVIHAIGLDVDQCQEYADAILQRVADIKKQSASGGNGGSGTSSGVISRLPSIDLPIFHGDLNEWVGFKNLFDSLVHGRSDLTASYKMAQLRGALRGEPGELVAHLPITNDNYAVARQILFDRYQNQRRLVDAQLARLFAIPKLSRASDIRTEVLNPVTVATKALGNLGLPVDQWSYLLFYIVAGRLPVEVLTRFEQQDNAGRDELPTLANLLAFLEAESRRHEIMPPPSSGSRVPASGHAVSVAQRGGGGDKRGPSQRLTALMAAVGGPRCAFCHESGHDVAACPRFRSTRIRGRRNIVAQRRWCFFCFGPHTASVCPQPQLCPNCDGRHHALLCLESAATPRSSGRSHLASPTGERTGRSPRQFGGVDPREEASQGGAGLEAVLLPTASVRVLDSDGNTVFARALLDSGAQGSIMSSNLAVRLGNPIYKSSYSIRGVGNVRISDVIGHTSFIFSSNPNPRLQFRVSALVMPEVIGRHPPVKVNSYIRSLTSDLRLADPKFDTPGPVDVLLGADVLGKLLLTGKRVLHAEGLVAMDTKLGHVLLGPAFRPVAARKSDNFLVGSTLSEVVQRFWELEEPPTAYRVNPDEEECELFYQNNTGRLYSGRFLLRLPFRANRPLLGSSRKAAETRLLSMERRMRRDAVFRQKYVEFMREYESLGHMSVSKVDWSATEHCFLPHHAVLKTPNGKIRVVFDGSVTTSSGVSLNQCLHSGPKLNRDISDILTSFRRHQIVFVADIRMMFRQTVIHPEDRRYQLILWRESSDEPIKIYELNTNTYGLRSSPYLAPLTSVTLCWLRMLTCRHCVGVGGALLICFPVRMGPLGLQRFWSGTRFSNERSQRCPGCQLIRDR

Summary

EMBL
LBMM01008464    KMQ88855.1    LBMM01010405    KMQ87487.1    GEBQ01004229    JAT35748.1    + More
LBMM01011051    KMQ87060.1    LBMM01007859    KMQ89359.1    GGMR01017784    MBY30403.1    GEBQ01025225    JAT14752.1    ABLF02008594    ABLF02030698    ABLF02030705    ABLF02030709    GGMS01014443    MBY83646.1    LNIX01000026    OXA42254.1    GGMR01010723    MBY23342.1    LNIX01000007    OXA51795.1    ABLF02008032    ABLF02035293    ABLF02060940    GGMS01010524    MBY79727.1    ABLF02002658    ABLF02034765    ABLF02042453    ABLF02001506    ABLF02008029    ABLF02035899    ABLF02037719    ABLF02046327    ABLF02064627    LNIX01000016    OXA46198.1    GGMR01011131    MBY23750.1    KK114194    KFM61875.1    ABLF02054908    ABLF02012239    ABLF02012241    ABLF02017372    ABLF02042178    ABLF02066436    ABLF02041614    GEHC01000869    JAV46776.1    GALX01005110    JAB63356.1    ODYU01012875    SOQ59395.1    GGMR01009860    MBY22479.1    GEHC01000939    JAV46706.1    LBMM01006490    KMQ90572.1    ABLF02028417    ABLF02042407    GEHC01000864    JAV46781.1    ABLF02035780    ABLF02028666    ABLF02066713    ABLF02021785    ABLF02008636    ABLF02065931    GGMS01012379    MBY81582.1    CR954257    CAJ14165.1    LBMM01010417    KMQ87475.1    ABLF02018732    ABLF02018734    ABLF02018737    RSAL01001808    RVE40681.1    LBMM01009746    KMQ87900.1    LBMM01009898    KMQ87805.1    ABLF02041650    ABLF02005684    LNIX01000018    OXA45284.1    GAMC01003146    JAC03410.1    ABLF02009462    ABLF02065929    GEZM01054766    GEZM01054765    JAV73410.1    ABLF02025193    GGMR01002024    MBY14643.1    GGMR01006575    MBY19194.1    LBMM01016077    KMQ84566.1    GGMR01002421    MBY15040.1    ABLF02042081    LNIX01000005    OXA54553.1    OXA54559.1    GGMR01013586    MBY26205.1    GGMR01020500    MBY33119.1    GGMS01014951    MBY84154.1    ABLF02034704    ABLF02034708    ABLF02034709    ABLF02044644    ABLF02055319    ABLF02006784    LBMM01015575    KMQ84755.1    LBMM01009888    KMQ87813.1    LNIX01000036    OXA39969.1    GEBQ01022991    GEBQ01006185    JAT16986.1    JAT33792.1    GEBQ01007199    GEBQ01000222    JAT32778.1    JAT39755.1    GBBI01004386    JAC14326.1    GEZM01060253    JAV71158.1    ABLF02008319    ABLF02008320    GGMR01003717    MBY16336.1    GBBI01004387    JAC14325.1    GEZM01054789    JAV73399.1    GGMR01016460    MBY29079.1    ABLF02008635    ABLF02023121    ABLF02065930    GEHC01000946    JAV46699.1    GEZM01060254    JAV71154.1    KQ977080    KYN05933.1    ABLF02005251    ABLF02055296    ABLF02030854    ABLF02067347    KQ973442    KXZ75531.1    ABLF02041762    ABLF02003339    ABLF02058001    ABLF02023723    OXA54454.1    GGMS01006636    MBY75839.1    LBMM01012568    KMQ86144.1    GBBI01004479    JAC14233.1    ABLF02022040    ABLF02056888    GBHO01006408    JAG37196.1   
Pfam
PF05380   Peptidase_A17        + More
PF18701   DUF5641
PF03564   DUF1759
PF05585   DUF1758
PF17921   Integrase_H2C2
PF00078   RVT_1
PF00665   rve
PF17919   RT_RNaseH_2
PF17917   RT_RNaseH
PF13843   DDE_Tnp_1_7
Interpro
IPR040676   DUF5641        + More
IPR008737   Peptidase_asp_put       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR005312   DUF1759       
IPR001584   Integrase_cat-core       
IPR008042   Retrotrans_Pao       
IPR012337   RNaseH-like_sf       
IPR001995   Peptidase_A2_cat       
IPR021109   Peptidase_aspartic_dom_sf       
IPR000477   RT_dom       
IPR001969   Aspartic_peptidase_AS       
IPR001878   Znf_CCHC       
IPR041373   RT_RNaseH       
IPR041577   RT_RNaseH_2       
IPR036875   Znf_CCHC_sf       
IPR029526   PGBD       
IPR017907   Znf_RING_CS       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
912
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.06968
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00073
outside
1  -  912
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
58.774884
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号