SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06018
Pre Gene Modal
BGIBMGA002876
Annotation
PREDICTED:_disintegrin_and_metalloproteinase_domain-containing_protein_11_isoform_X3_[Papilio_xuthus]
Location in the cell
Nuclear   Reliability : 2.588
 

Sequence

CDS
ATGTCACTAACCGGGTCACGTTTGTTTTTCGGTTCGTTCCAGCAGAAGCACCCACATGTCATCTTCGAAGCGAGAACTAAGGCCAACAAGGGCTGCGCTAACAAACTCGAGTACCGACCGAAGAACAGGAGAACGAAGAACGTGGGCTACCTGGAAGAGCCGCTCGACGACGACCCCACAAGTTTATTAGCACCAGGTCGTCTGAACCAAGAACGCAATTGGCGCTGGTTGTGGAGCGGGGGAGTCAAGGGCTTAATCGAACGGCTCCGCAGAGACGTCAGGGAGACAACGAAATATATAGAAACAGCCCTGGTGATAGACAAGGCCATGTTCGACAGGAGAAACGGAAGCACTAGAGCTGAAGTGGTTCATGATGCGATACAAGTCGCCAATATTGCCGATCTGTATTTCCGTACGCTGAATACTAGGGTCTCACTGGTGTACATCGAGTCGTGGCAGGGTGCTGACCAAGCCGCCATCGACAGGAAGGCGGACATCACGAGAGCCATCCACACCTTCAGCGACTACGCGGCGAGAAAACTATTCAAAATCGAAAAGGACACGACACAACTTCTCACCGGCATAATGTTTCCGGGCGGAGAATCCGGTATCTCGGTACCAGACACCATGTGTACTCCAAAATCTGTTGGCATATCCGTCGACACTAACACGTACGAGCCACATCTTCTGGCCGGCACCATGGCGCATATGATCGGACATAATATCGGGATGGGCCACGACGATGGCCGGGAGCAGTGCTTCTGCCGCGACTGGCACGGCTGCATCATGGCGCAATCCATCGTCGGCTCTGACAACGTCCAGCCCTACAAATTTTCTGACTGCTCTAAGAATGACTACATCAACGATCTCAGGGTCGGGCAAGGTCTCTGCTTGCTGAACAAACCTAATGAATTGGTGATCCATCATCAGTGCGGCAACGGCAAGCTTGACGAAGGCGAGGAGTGCGACTGCGGGACCCTGAACGAGTGCCACAACTCTAACCCGTGCTGTGACCCGTTCACCTGCAGACTGACCAAGGAAGCTCAGTGCGCGTCCGGGGAGTGCTGCGAGAGGTGCCAGCTCAAGCCCCGCGGAGTTGTGTGTCGTGACGCGACCAACGAATGCGACTTAGAGGAAACTTGCACCGGCCTATCCGGGGCTTGTCCAGCTGACTCCTACCGGAAGAACGGCGAATCTTGCGAAGACGGCAAGGGGTACTGCTTCGCCGGACAATGTCCCACATTATCTCTGCAATGCGAGAGAATATGGGGCACCGGTACTGTTGGAGCGGACAAGGAATGCTTCGAACAGTTCAACTCTAAAGGAGCTGTGACCGGCCACTGCGGGAAGGACAGTAACGGACACTACATTAAGTGTGAAATGGAGAACGTTCGCTGCGGCTCTCTACAATGCCAATTAGGGAACAGATATCCTGTTGTGACCGGAATGGATGAGTACTATACGAGAACCGTCATCACTATTAAGGGGAACGAATATGAGTGCAAAGCAACGACTGGTCTACCGAAGCACTCGGAGATCGCTCCCTTAGGGCTGGTCAGGGATGGAACCCCGTGCGGCGACAACCTCGTCTGCGTCAACCAGACCTGCACCTCTATATTCCCTTTCATCGACCACACCAAGTGCCCAACGGACCACAACAACCACGAGTGCTCAGCCCGAGGGATTTGTTCGAACCTAAACAAGTGCGTCTGCAACCGAGGCTGGACGGGTCCAGATTGTTCACAGCACGACGCCCTCCCACCCTCGCCGACTCCCTACGTACCAGAGAACGCCACGAAAGCAGCATACAACATGACCAAAAAGGAAACACCGTATGAGAACTACCACGGCTCGAACACGGTGTTCCTCGTGGCGGTCCTCATGTCTGTGGTAGGGGGGGTATTCATAGTATTTGCCCTGAGCGCTCTCTGCTACAGGAAAAAGAGCACGTCGAGAAAGTACGACCCGCCCTACGTGAAGAAGCCCATAGCGAAGAGTTTCGCCGCGGGTTCGACGACCTCCAACAATTCACAGGAGGACATATCGCTCGATGGCGGGAAAATGCACTCTTTCAACAACACTTTCAGCCGAGATTCGCAGCGTGTGATATTCAGACATGGCAATCACATGGCAGGGGCCAGCAGTACAAGCAGATATCCAGATCACAAGCAAATGAAGCGGGTGCATTCTGGTAGCGAAGACGAACCCACACATTCAGGCGAAGAAGACATAGCATTCATAGACGTAGCCTCTAACTCGATGGCGAAATTGCCAGAAAAAGGTATCCTGAAGAAGCACGGGTACGGAGCTGTGGATGGGAAGGACAAATGGGGAGACGACTCGCAGTCGGAGCAGCTCGAGGCTGGCTCGCAGTCCGATGGGCAGGAACCGGCAGGGGCTGTTGCCGATATGGAATACAAGTTTAAGGATCTGAACGGCTATCACGAGAACATAATAGTGGCCTTGAAGACGGCCGCGGCGCAACGTGCGAGCGCTGCAGGAGGCTCCGGTGATCTTCGCTCCCTCCAGGACTACGAGTACAAGGAGCGGAGGGAACGAGCCCCCAGCGCAGAGAAGATCCACGACGCGGAACTGCGAAGACAGCGCCCCGACGACGAAGAGGACGACGCTCCACAGTGCGCCCCCATCAGAATCAGGAACCTGGAGGACTTGATACGGCAACTAGAGCACCACTCGAGCAGGCACATGAGCCCGTCCGGCTCTGAAGATATAAGGATGTCGGAGACGGAAGCCGATCGACACTACAGGATCGAGCCTGGAGAGATCCCACCTCGATGTCGCGGCCGCATCCCCGGCGAAGAGGAGGCCCACTTCTCGTACCGTTACCGCGGCGGGTCTGGCCGGCACCACAGCGCGATGTTCGGCGCCGGCCCGCCCCCCGCGCCGCGCCTTCCCCCCGACGAGGACGCGCTCTACGAGACGGCCGACGCCGAGCGACTCCGCGACGCACCAGACAGCGAAAGTGATGAATTTATTCAAGCTCAACAACAGTTAGCCCCGTGGGCGAGTGAGGAGCGAGTGGGGCGGCCATCTCACCGCCGGGCCCCGTCCCCGCCCGACGAAGACTCCCCTGCCGCCTTCCCCGAGTACACACACTGA
Protein
MSLTGSRLFFGSFQQKHPHVIFEARTKANKGCANKLEYRPKNRRTKNVGYLEEPLDDDPTSLLAPGRLNQERNWRWLWSGGVKGLIERLRRDVRETTKYIETALVIDKAMFDRRNGSTRAEVVHDAIQVANIADLYFRTLNTRVSLVYIESWQGADQAAIDRKADITRAIHTFSDYAARKLFKIEKDTTQLLTGIMFPGGESGISVPDTMCTPKSVGISVDTNTYEPHLLAGTMAHMIGHNIGMGHDDGREQCFCRDWHGCIMAQSIVGSDNVQPYKFSDCSKNDYINDLRVGQGLCLLNKPNELVIHHQCGNGKLDEGEECDCGTLNECHNSNPCCDPFTCRLTKEAQCASGECCERCQLKPRGVVCRDATNECDLEETCTGLSGACPADSYRKNGESCEDGKGYCFAGQCPTLSLQCERIWGTGTVGADKECFEQFNSKGAVTGHCGKDSNGHYIKCEMENVRCGSLQCQLGNRYPVVTGMDEYYTRTVITIKGNEYECKATTGLPKHSEIAPLGLVRDGTPCGDNLVCVNQTCTSIFPFIDHTKCPTDHNNHECSARGICSNLNKCVCNRGWTGPDCSQHDALPPSPTPYVPENATKAAYNMTKKETPYENYHGSNTVFLVAVLMSVVGGVFIVFALSALCYRKKSTSRKYDPPYVKKPIAKSFAAGSTTSNNSQEDISLDGGKMHSFNNTFSRDSQRVIFRHGNHMAGASSTSRYPDHKQMKRVHSGSEDEPTHSGEEDIAFIDVASNSMAKLPEKGILKKHGYGAVDGKDKWGDDSQSEQLEAGSQSDGQEPAGAVADMEYKFKDLNGYHENIIVALKTAAAQRASAAGGSGDLRSLQDYEYKERRERAPSAEKIHDAELRRQRPDDEEDDAPQCAPIRIRNLEDLIRQLEHHSSRHMSPSGSEDIRMSETEADRHYRIEPGEIPPRCRGRIPGEEEAHFSYRYRGGSGRHHSAMFGAGPPPAPRLPPDEDALYETADAERLRDAPDSESDEFIQAQQQLAPWASEERVGRPSHRRAPSPPDEDSPAAFPEYTH

Summary

EMBL
RSAL01000215    RVE44128.1    NWSH01001468    PCG71158.1    NEVH01021192    PNF20107.1    + More
KK853105    KDR11298.1    DS235867    EEB19412.1    JTDY01001848    KOB72726.1    KQ977634    KYN01159.1    ADTU01018390    ADTU01018391    ADTU01018392    ADTU01018393    KQ976465    KYM84340.1    KQ435810    KOX72939.1    ACPB03017714    ACPB03017715    ACPB03017716    ACPB03017717    GL888755    EGI58128.1    KQ980304    KYN16754.1    UFQS01001658    UFQT01001658    SSX11763.1    SSX31328.1    KK107681    EZA48108.1    GBYB01004467    JAG74234.1    KQ982254    KYQ58599.1    GL447952    EFN85648.1    SSX11761.1    SSX31326.1    KQ760974    OAD58585.1    AAAB01008811    EAA04951.4    GL434909    EFN74315.1    OUUW01000011    SPP86479.1    CM000162    KRK06394.1    CH940651    KRF82182.1    KRK06397.1    KRK06396.1    CH954180    KQS30260.1    KQS30252.1    AE014298    AAF48548.6    KRK06395.1    KQS30258.1    ACL82932.1    AFH07417.1    KQS30256.1    GAMC01015144    JAB91411.1    AFH07418.1    KRK06391.1    KRK06392.1    KQS30257.1    KQS30261.1    KRK06399.1    KQS30253.1    KQS30262.1    KQS30254.1    KQS30255.1    GAMC01015150    JAB91405.1    AGB95433.1    KQ981820    KYN35337.1    AXCN02002021    CH963925    EDW78432.2    KRK06393.1    KQS30259.1    CP012528    ALC49632.1    AHN59781.1    AGB95432.1    GBYB01000575    JAG70342.1    CVRI01000054    CRK99996.1    KQ414619    KOC67738.1    GBRD01005998    JAG59823.1    GBRD01013448    JAG52378.1   
Pfam
PF01562   Pep_M12B_propep        + More
PF00200   Disintegrin
PF08516   ADAM_CR
PF07974   EGF_2
PF01421   Reprolysin
Interpro
IPR002870   Peptidase_M12B_N        + More
IPR006586   ADAM_Cys-rich       
IPR036436   Disintegrin_dom_sf       
IPR024079   MetalloPept_cat_dom_sf       
IPR034027   Reprolysin_adamalysin       
IPR018358   Disintegrin_CS       
IPR013111   EGF_extracell       
IPR001590   Peptidase_M12B       
IPR000742   EGF-like_dom       
IPR001762   Disintegrin_dom       
IPR013032   EGF-like_CS       
SUPFAM
SSF57552   SSF57552       
Gene 3D
PDB
5Y31     E-value=1.71889e-83,     Score=792

Ontologies

Topology

Length:
1039
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
22.76069
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00206
outside
1  -  620
TMhelix
621  -  643
inside
644  -  1039
 
 

Population Genetic Test Statistics

Pi
24.310643
Theta
23.935775
Tajima's D
0.255414
CLR
2.460794
CSRT
0.448877556122194
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号