SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06016
Pre Gene Modal
BGIBMGA002824
Annotation
hypothetical_protein_KGM_13318_[Danaus_plexippus]
Location in the cell
PlasmaMembrane   Reliability : 4.576
 

Sequence

CDS
ATGATCGATTTATATCAACGAATCGTATTTATTGTTCTCATTTGGACGATTGCGTCGACCGCTAAAACAACATGCCCTATTGGATTCCAATTCGCAGAATACAAGTCAGGCAACCGCGGACTGTGTTACCGCATCAAGGGCCCAGAAAGATTCTCTGATATATACAAAAACTGCACCGGGAATCTATACACAGTCGAACGCTATAACAATTTAAAAATACCAGAGCACGAATATGCTTTGTGGACGCAGTACAAAAACGCATATCCTGGGGGGCGATTCGTGGACTGGTCTTATACAGAGACAACTGGAAGACTGCTACGTGAGAAAGTTCAACAAAATGAATCACTACTGAACCAGGATCTGTGCGTGGTGATAGACTCAATCACCAGTTTCACGGCAGTCAGTTGTGAAGCAATGCATCACAGGTATTGCTTGGTTTATCCCTATGAAGACGAAAAGGCTTTAAAGAGTCAACCTTGTGCGGGTTTCGATAATGGCTATAGATTCTATAGTCCGATGCCTACGTGTTTGGCGGAGGTACCGGCTGTAGGTGAAGCAGCTGTCAGAGCAACATGGAAACAAGCTAAAAACATATGCGAGAAACGGGGAGGATACCTTTTGAACTTTGGATGGATGTATTCCAACTTCAGGAGCTTTTCGCACTCGGCCTATCCTTTGGGTTTCGCTTTTAATTCTGAACTTACGGAGCTCAAGTTACACCTCAATAACGGGACTATTTTGATACCAAGATCGGAATGGAAATTTTCAGAATTGCCTCAAACCAATAAAACTCGTTTAAGTGCTGTGGGGAATAATATGTGGTTCTCCGTGAACAGTTCATTTGTGTTCTATGCCGTGATATGTGAGGTATCCGTACCAGTGAAGGATGTTGTATTGAATCTTACAATCGATTCCGATGACAGACTCATTTTAAACGTAAGCGAGCCAGTACCGAGAAGGTATTTGAAGTGCTTCACCGACTCAGTGAAGTACTACCCCACTCCAGTGGACTTGGACCACGACGAAGAAAACACTTACGTGGTTCAGGAAAAGAAGAACGGTTACTATTGGTGTATTCACACGGATTCCAAGAGCTACACGATCTCGCAATCCAATAAGGTTTTGCACATACCAAAGAAGAACTCCTTGGACCACGTGTACGCCGTCAAACTTCATCTACAGTCTTATACAGATCCTGAAAAAATTTACAAGGCACTAGAAAAGCTGGAAGAGTACATATACTTATCGACCAAGTATTTTAATGTTCATGGGAACGATGCGGCAACGGAGGATCAACTGAGGAGTTTTGAATTGACAACACCTTCGGTCGGTGTAAGAGAAGTGCTGTCCAACGCTAGGCTAAAGAAGTGGTTCGTTGGTGGTAGAGCGTTGTTGGTTCACTTCGAACTCGATTCCAGCATGAGACCCGTCCGCCCTGGGACCTGGAAAGGGCTTGAATTAGTTTTTATGAAGCCCGTGTACTACTGCCCTGACGAGAGCTTGGAAAGCGGCGAAGCGAAGCACTTAGGTGAATCGATATCGAACACAAGATGTCAGACGAGGAAATGCGTGGGAGATTACAACGAGGGCGTGCAGTGGCTTCTGACCACGACCAGCGACTGCGAGATGAGGCTCCCGGTGACCCTGTCCAACGCGCTCAAGGTCAAAGAGGTCACGCAGCTGATGCCGACCGTTGCGAACTTACTACCCGACCACACGTTTGGGGTTCTGGATACGGAATCCACGACTCCCGCCGAGGGATACACACAGACGACAACCGAAACACAAACCGCTACAAATGATCCCGTACTACGCGATGTACGCGACAGCTCCGAGGAGATCACCGAAACCACTCGGAGACCGACTCGGCCTCCGCCTCCGCCAACTGACCCGGTCATCACCGTAACGACCCCCACTGACGTCATCACAGCCGTACCTACCATGCCTCCAACCACAATGCCCAGACCCTCGCCAGAAGACCAGCTTCTACAAGTAATGGAAAATCTAGAATCCATCATCAATAACGCATCGTTGGCAGTCTCCCTGGAAACTATTAGCAGTTCGTTTGATCAGGTAGACGGTCTATTATCCGAGGACGACGATCTGGACATACCTGGCGAACTTCTGCATTTGCTGGACAATATTGGTCCTAGACTAAATTTAGACGGATCAGATGCAGCGACAGTTAGGGAGAACATCGCCCTTGTGGTCGCTAAGGGCGACGAGAGCCTCCCGATGAGAGGCTTGAGGTTAGCCACCAGAGACACTGATGCTTTTACGGATCATGCCTTTGAGGTTATCAGAGATGAAATAAACTCAAGCTTACTCCAACCGGAGCTCAGTGATGTTGTGGTCAAGATACCGGGGTCGGTGTCCGTTTCCAATAGGAGGGTCAGCTTCGTGGTGTTCAGAACTGACCGCGCCTTCAGAAATCCAGGGTCCGAGTATTCCGTGAACAGCAGAGTCGTCAGCATCAAGATAGGGAACCTGACGCGGTTTCAAAACGAGGAGTTTATCGACATTTATCTGAATCCAATAGTGGAACTGCCGGGGAGCAAGCAAAAGCGAGTTTGCGCGTACTGGGAGTTCCTAGAGGACGGAACAGGGTACTGGTCACAGGACGGATGTGTTCTGATGCGCTCTGAAGATGAAGGGATGCTGGATTACTGCCGATGCACTCATCTGACACACTTCGCTGAGATTCTCATACCTAGGACGTCCTTCTCTGACGCCCACGAAAACGCTCTCGAGCTGATCTCTGTGATCGGCTGCTGTGTCTCCATTTTAGGGCTGGTCTTGGTCGCCATCACCGCGATCCTCTTCAGGTCCTGGCGCCGGGATTTCACCAACAAAATCTGGCTGCAGCTCTGCCTCGCTATATTCATAACCAGCGTCTGCTTCCTCGTCATCGTGTTCGCTGACTTCCTGGAGTACAACATCGCTTGCATGCTGGTCGGGGTTTTGTTGCACTACGCTGTCTTGGCGTCCTTCTGTTGGATGCTGGTCGCAGCTATCATTTCGTATAGGAAACTGGTGATAGTGTTCTCCAGAGACGCTTCGCACAAGCTGCTGAAGGCGTCCGCGTTTTCGTGGGGAGCTCCGTGTGCCGTGGTCGGCGTGCTTCTGTCGGTCGCTCCGCACTCGTACGCGGGACAATTCGACGGAGACGTTCGCAGCGGGGCCTTCTGCTATCCCTCGGGGCTGTCGTTGTGGCTGACGGTGTACGCTCCCATCGCCGTGATGCTGCTGGTGAACTGGACGTTATTCCTCCTGATAGTGCGCTCCGTGTTCGCTTCCCGAAGGATCCAGAGGCACGGGGACTCGAACGAGGCGCTCCGTTGTGCGTCCGTCTCCTGTCTTCTGGTCTTCTTGTTCGGTCTGCCGTGGGTCTTCGGTTTGTTCCTGAACAACATCGTCACGGTGTACTTGTTCAACTTGACCGCGACCTTTCAAGGTTTCGTGCTGTTCCTCTTCTTTGTCCCGGGCAATAAGAAGACCAGGGATCTGTGGTTGAACAAGTTGAAGATCAAGCAGACGCGCAAGGTTCCGGTCACGTCCTCGACGTATACGAATAGGAGCACCGGTGGAAACCCTGGCTCCAGGGTAGGGAACACAAGTGTACCTGCGCAATCCAAAGAGACCAAGCCCAGGTCTATGTCTTCCAGTGACGACTCAAGGTTCTCTTGA
Protein
MIDLYQRIVFIVLIWTIASTAKTTCPIGFQFAEYKSGNRGLCYRIKGPERFSDIYKNCTGNLYTVERYNNLKIPEHEYALWTQYKNAYPGGRFVDWSYTETTGRLLREKVQQNESLLNQDLCVVIDSITSFTAVSCEAMHHRYCLVYPYEDEKALKSQPCAGFDNGYRFYSPMPTCLAEVPAVGEAAVRATWKQAKNICEKRGGYLLNFGWMYSNFRSFSHSAYPLGFAFNSELTELKLHLNNGTILIPRSEWKFSELPQTNKTRLSAVGNNMWFSVNSSFVFYAVICEVSVPVKDVVLNLTIDSDDRLILNVSEPVPRRYLKCFTDSVKYYPTPVDLDHDEENTYVVQEKKNGYYWCIHTDSKSYTISQSNKVLHIPKKNSLDHVYAVKLHLQSYTDPEKIYKALEKLEEYIYLSTKYFNVHGNDAATEDQLRSFELTTPSVGVREVLSNARLKKWFVGGRALLVHFELDSSMRPVRPGTWKGLELVFMKPVYYCPDESLESGEAKHLGESISNTRCQTRKCVGDYNEGVQWLLTTTSDCEMRLPVTLSNALKVKEVTQLMPTVANLLPDHTFGVLDTESTTPAEGYTQTTTETQTATNDPVLRDVRDSSEEITETTRRPTRPPPPPTDPVITVTTPTDVITAVPTMPPTTMPRPSPEDQLLQVMENLESIINNASLAVSLETISSSFDQVDGLLSEDDDLDIPGELLHLLDNIGPRLNLDGSDAATVRENIALVVAKGDESLPMRGLRLATRDTDAFTDHAFEVIRDEINSSLLQPELSDVVVKIPGSVSVSNRRVSFVVFRTDRAFRNPGSEYSVNSRVVSIKIGNLTRFQNEEFIDIYLNPIVELPGSKQKRVCAYWEFLEDGTGYWSQDGCVLMRSEDEGMLDYCRCTHLTHFAEILIPRTSFSDAHENALELISVIGCCVSILGLVLVAITAILFRSWRRDFTNKIWLQLCLAIFITSVCFLVIVFADFLEYNIACMLVGVLLHYAVLASFCWMLVAAIISYRKLVIVFSRDASHKLLKASAFSWGAPCAVVGVLLSVAPHSYAGQFDGDVRSGAFCYPSGLSLWLTVYAPIAVMLLVNWTLFLLIVRSVFASRRIQRHGDSNEALRCASVSCLLVFLFGLPWVFGLFLNNIVTVYLFNLTATFQGFVLFLFFVPGNKKTRDLWLNKLKIKQTRKVPVTSSTYTNRSTGGNPGSRVGNTSVPAQSKETKPRSMSSSDDSRFS

Summary

Similarity
Belongs to the G-protein coupled receptor 2 family.
Uniprot
Pfam
PF01825   GPS        + More
PF00002   7tm_2
Interpro
IPR000203   GPS        + More
IPR017981   GPCR_2-like       
IPR000832   GPCR_2_secretin-like       
ProteinModelPortal
PDB
4L6R     E-value=1.18133e-05,     Score=121

Ontologies

Topology

SignalP
Position:   1 - 21,         Likelihood:  0.987989
 
 
Length:
1228
Number of predicted TMHs:
7
Exp number of AAs in TMHs:
167.55476
Exp number, first 60 AAs:
10.29865
Total prob of N-in:
0.45498
POSSIBLE N-term signal
sequence
outside
1  -  918
TMhelix
919  -  941
inside
942  -  953
TMhelix
954  -  976
outside
977  -  985
TMhelix
986  -  1008
inside
1009  -  1028
TMhelix
1029  -  1051
outside
1052  -  1070
TMhelix
1071  -  1093
inside
1094  -  1113
TMhelix
1114  -  1133
outside
1134  -  1137
TMhelix
1138  -  1160
inside
1161  -  1228
 
 

Population Genetic Test Statistics

Pi
26.695033
Theta
23.382185
Tajima's D
0.444989
CLR
20.449421
CSRT
0.507674616269187
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号