SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO06014
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.459
 

Sequence

CDS
ATGGTTAGGAACGACAGGCTCGCTGCTCGTGGTGGTGGTACCGTCATTTACTATAGACGAGCCTTGCACTGCGTCCCACTCGACCCCCCCGCGCTTTCTAACATCGAAGCATCAGTATGCCGAATCTCACTGACTGGACACGCGCCGATCGTTATCGCGTCCGTTTATCTTCCACCGGATAAGATCGTTCTAAGCAGTGATATCGAGGCGCTGCTCGGCATGGGAAGCTCTGTCATTCTGGCGGGCGACCTAAATTGTAAACACGTCAGGTGGAACTCACACACCACAACCCCGAATGGCAGGCGGCTTGACGCGTTAGTCGATGATCTCGCCTTCGATATCGTCGCTCCGCTAACCCCGACTCACTACCCGCTAAATATCGCGCATCGCCCGGATATACTCGACATAGCGTTATTAAAAAACGTAACTCTGCGCTTACACTCGATCGAAGTAGTTTCAGAGTTAGATTCAGACCACCGTCCCGTCGTTATGAAGCTCGGTCGCGCTCCCGATGCCGTTCCCGTCACGAGGACTGTGGTGGATTGGCACACGCTGGGCATCAGCCTGGCTGAATCTGATCCACCATCGCTCCCGTTTAGCCCGGACTCTACCCCGTCTCTTCAGGATACCGCTGAAGCCATAGACATCTTAACGTCACACATCACCTCGACATTAGATAGGTCATCGAAGCAAGTTGTAGCGGAGGACTTCCTTCACCGCTTCAAATTGCCCGACGATATTAGGGAACTCCTTAGAGCTAAGAACACCTCGATCCGCGCCTACGATAGGTATCCTACCGTGGATAATCGTATTCGAATGCGTGCCCTACAACGCGACGTAAAGTCTCGCATCGCCGAAGTCCGAGATGCCAGATGGTCTGAGTTCTTAGAAAGACTCGCACCCTCCCAAAGGTCTTACTACCGCTTAGCTCGTACTCTCAAATCGGATACGGTAGTAACTATGCCCCCCCTCGTAGGCCCCTCAGGCCGACTCGCGGCGTTCGATGATGATGAAAAAGCAGAGCTGCTGGCCGATACATTGCAAACCCAGTGCACGCCCAGCACTCAATCCGTGGACCCTGTTCATGTAGAATTAGTAAACAGTGAGGTAGAACGCAGAGAAAGAAAGAAAGAAAGAAAATCTTTATTCGCCAGAAATATAGTTTACAAGATATAG
Protein
MVRNDRLAARGGGTVIYYRRALHCVPLDPPALSNIEASVCRISLTGHAPIVIASVYLPPDKIVLSSDIEALLGMGSSVILAGDLNCKHVRWNSHTTTPNGRRLDALVDDLAFDIVAPLTPTHYPLNIAHRPDILDIALLKNVTLRLHSIEVVSELDSDHRPVVMKLGRAPDAVPVTRTVVDWHTLGISLAESDPPSLPFSPDSTPSLQDTAEAIDILTSHITSTLDRSSKQVVAEDFLHRFKLPDDIRELLRAKNTSIRAYDRYPTVDNRIRMRALQRDVKSRIAEVRDARWSEFLERLAPSQRSYYRLARTLKSDTVVTMPPLVGPSGRLAAFDDDEKAELLADTLQTQCTPSTQSVDPVHVELVNSEVERRERKKERKSLFARNIVYKI

Summary

EMBL
U07847    AAA17752.1    AB055391    BAB21761.1    AB018558    BAA76304.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    GEZM01008457    JAV94772.1    GEBQ01004157    JAT35820.1    KB632143    ERL89075.1    ABLF02008153    ABLF02008462    ABLF02008464    GGMR01012189    MBY24808.1    ABLF02012584    ABLF02013765    ABLF02024884    KQ973342    KXZ75569.1    GBBI01004395    JAC14317.1    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    GGMR01004661    MBY17280.1    ABLF02022418    GALX01005299    JAB63167.1    GGMS01012398    MBY81601.1    KK115285    KFM64681.1    ABLF02025082    ABLF02039175    ABLF02041809    ABLF02003241    ABLF02003242    ABLF02025904    ABLF02065839    GEBQ01003077    JAT36900.1    GEZM01021868    JAV88847.1    ABLF02041767    LBMM01018021    KMQ83899.1    KK118005    KFM71947.1    GGMR01018716    MBY31335.1    KK113281    KFM59799.1    GGMS01006359    MBY75562.1    ABLF02010814    ABLF02010815    ABLF02037860    ABLF02037869    GFTR01008262    JAW08164.1    GFTR01008279    JAW08147.1    GGMR01016297    MBY28916.1    ACPB03027378    GGMS01010725    MBY79928.1    JTDY01005246    KOB67202.1    ABLF02014934    ABLF02014939    ABLF02017810    GGMR01000226    MBY12845.1    KQ971729    KYB24751.1    GFTR01008271    JAW08155.1    GEZM01099921    GEZM01099920    GEZM01099918    GEZM01099906    JAV53125.1    NEVH01023280    PNF18085.1    GGMS01006655    MBY75858.1    ABLF02015631    ABLF02021986    ABLF02021987    ABLF02021991    ABLF02009591    ABLF02009592    ABLF02009594    ABLF02066703    ABLF02023911    ABLF02034467    ABLF02042518    ABLF02057746    LBMM01014024    KMQ85369.1    GBGD01000415    JAC88474.1    GFTR01008260    JAW08166.1    KK119261    KFM75202.1    ABLF02028535    ABLF02028545    GALX01005359    JAB63107.1    ABLF02042385    ABLF02066437    GGMR01001088    MBY13707.1    GEZM01021881    JAV88842.1    GEDC01029594    JAS07704.1    KB632327    ERL92508.1    GGMS01002992    MBY72195.1    GFTR01008151    JAW08275.1    ABLF02043963    KK119692    KFM76444.1    ABLF02037715    ABLF02001804    ABLF02035179    ABLF02062794    MCIT02004487    PHT96476.1    GGMR01015412    MBY28031.1    GBBI01003747    JAC14965.1    GFTR01008261    JAW08165.1    GECL01003538    JAP02586.1    GFXV01000908    MBW12713.1    GGMR01012443    MBY25062.1    GGMR01016905    MBY29524.1    GGMS01014910    MBY84113.1    ABLF02007779    ABLF02007782    ABLF02050375    ABLF02023801    KK119069    KFM74603.1    KU543685    AMS38375.1    JTDY01002082    KOB72150.1    GFTR01008251    JAW08175.1    GFTR01008257    JAW08169.1    GGMS01000479    MBY69682.1    NWSH01007753    PCG62823.1    GGMR01003864    MBY16483.1    GBBI01004571    JAC14141.1    JTDY01011738    KOB53653.1    NEVH01016302    PNF25823.1    GGFK01009732    MBW43053.1    ABLF02009968    ABLF02049343    ABLF02056173    ABLF02063327    ABLF02065784    GGFK01009846    MBW43167.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF14291   DUF4371
PF07530   PRE_C2HC
PF05699   Dimer_Tnp_hAT
PF07727   RVT_2
PF03372   Exo_endo_phos
PF03564   DUF1759
PF18701   DUF5641
PF00665   rve
PF05380   Peptidase_A17
PF17921   Integrase_H2C2
PF05585   DUF1758
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR025398   DUF4371       
IPR006579   Pre_C2HC_dom       
IPR012337   RNaseH-like_sf       
IPR008906   HATC_C_dom       
IPR006580   Znf_TTF       
IPR013103   RVT_2       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR005312   DUF1759       
IPR040676   DUF5641       
IPR008737   Peptidase_asp_put       
IPR008042   Retrotrans_Pao       
IPR001584   Integrase_cat-core       
SUPFAM
SSF56219   SSF56219        + More
SSF53098   SSF53098       
Gene 3D

Ontologies

Topology

Length:
391
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0685599999999999
Exp number, first 60 AAs:
0.05174
Total prob of N-in:
0.05324
outside
1  -  391
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
22.396723
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号